Home
| Quotations
| Misc
Notes | Notes
2 | Hair
| DemicDiff
| Diversity
| DNA|
Asian
IQ | Keita2008
data | Blood | African
Tmeline
Egypt in Africa
| Black-Greek-DNA links
| Notes 3
|Notes 4| Notes
5 | Notes
6 | Notes 7 | Misc
news clips
|
Ethiopians
| Nubians
|
Contents | History | Cranio-skeletal research | Mixed pop | DNA methods | DNA research problems | Sahara - Sudan- Levant | Continuity | Languages | Cultural linkages- Nubia-Egypt-Sahara | Visual images | Summary | Misc Notes | Hair | DemicDiff |
Source:
http://exploring-africa.blogspot.com/2008/01/ancient-ghana-mali-nok-almoravids-moors.html
Excerpts:
One-Stop Timeline Index - a chronology of developments across continental
Africa.
CHRONOLOGY OF ANCIENT WEST AFRICA
From 30,600 to 10,000 BC: "A cultural flow, from the southeast of
Subsaharan Africa and to the Sahara, could explain the diffusion of the
microlithic industries all the way through West Africa. We observe them
initially in Cameroon at Shum Laka (30.600-29.000 BC), then at the Ivory Coast
in Bingerville (14.100-13.400 BC), in Nigeria in Iwo Eleru (11.460-11.050 BC),
and finally in Ounjougou (phase 1, 10th millennium BC)." [see: Human
population and paleoenvironment in West Africa]
23,000 BP ~ 21,050 BC: "After a favourable climatic period,
characterised by relatively dense and diversified Palaeolithic occupations, the
arid Ogolian begins locally around 23000 years BP and is represented at
Ounjougou by a significant depositional and archaeological hiatus." [see:
Aziz Ballouche]
*Some time at more or less 18.8ky ago, E3a carriers trace their common
recent ancestor back to this period [see: Semino et al, 2004]. In the meantime,
if Goncalves et al.'s words are any indicators to go by, E-M33 (E1) carriers,
also ancestral to contemporary West Africans, were likely already in Western
regions of what is now desiccated Sahara and which now grades into
Sahel-sub-Saharan region, possibly amongst groups of older lineages like B (M60)
and perhaps to a lesser degree A (M91), prior to the arrival or any significant
presence of E3a carriers in west Africa originating eastward...
The prescence in Portugal of both the A and E1 haplogroups may be independent
from the slave trade (otherwise E3a would be well represented since it comprises
the majority of West African lineages). These findings either suggest a pre-neolithic
migration from North Africa or a more recent origin from a founder population of
small size that did not carry haplogroup E3a, which is a major component in
North African populations today. TMRCA for Portuguese E1 lineages estimated as
22.9 +/- 7.2 ky favors the first scenario..." — Goncalves et al
After 12,000 BCE ~ 14ky ago: Beginning of a wetter phase in Africa north
of the equator. Populations ancestral to most West Africans make up the foragers
and hunters of these lands.
10th millennium BC ~ 12ky ago: At Ounjougou - "It is not until
the Holocene and the return of humid climatic conditions, beginning in the 10th
millennium BC, that it is possible to again observe evidence of human
occupation." [see: Aziz Ballouche]
"Consequently, it has to be seen in the context of heavy rainfalls and a
resettlement of the vegetation cover, during the 10th millennium BC, that a new
population arrives on the Plateau of Bandiagara." [see: Human
population and paleoenvironment in West Africa]
Between 10th and 9th millennia BC: "Some charcoal are present at
the transition between the 10th and 9th millennia BC, but it is currently
impossible to determine if it is of anthropic origin or natural." [see:
Aziz Ballouche]
The 10,000 and 9,000 BC (Phase 1 of the Holocene in Ounjougou): "The
first sedimentary sequence of the Holocene can be observed at the Ravin de la
Mouche. It's a channel dug into yellow Pleistocene silt and filled with coarse
grained sand and pebbles. As a chronological reference for the upper levels of
this early Holocene site, we hold ten radiocarbon dates between 9400 and 8400 BC
cal. The associated lithic industry evidences predominantly a unidirectional
mode of debitage. But also other technologies, such as bipolar on anvil or
multidirectional, have been applied by the Early Holocene population. The raw
material mainly used was quartz. The typological range consists of small
retouched flakes, geometric microliths and perçoirs, but also of continuously
retouched bifacial arrowheads and backed points." [see: Human
population and paleoenvironment in West Africa]
ca. 11,000 BP: Archeological indicators of Yam cultivation in west Africa
in the vicinity of the Niger delta region. [Specific notes on this will follow
shortly]
"By" 11,000 years BP ~ by 9050 BC:
"The age of the sediment in which they were found suggests that the six
ceramic fragments discovered between 2002 and 2005 are at least 11,400 years
old. Most ancient ceramics from the Middle East and the central and eastern
Sahara regions are 10,000 and between 9-10,000 years old, respectively."
[see: Human population and paleoenvironment in West Africa]
By the 'beginning' of 8,000 BC: "Outstandingly, there has been
evidence of the presence of pottery and seed grinding implements since at least
the beginning of the 8th millennium BC. It is therefore the oldest site. The
eighth millennium (Phase 2 of the Holocene in Ounjougou) known of this
socio-economic type in sub-Saharan Africa...
The pottery and the seed grinding implements of phase 2 of Ounjougou are the
oldest artefacts of this type known at present in sub-Saharan Africa. To current
knowledge, the pottery of Ounjougou could either have been invented in the
actual Sudano-Sahelian zone or been imported from the Central Sahara, where
there has been evidence since the ninth millennium BC. Still, the oldest pottery
known in the Sahara, from the site of Tagalagal in Niger, is already quite
diversified at the moment of its appearance, possibly meaning that the technique
has been introduced.
The lithic industry of the phases 1 and 2 on the other hand shows similarities
to both more southern and Saharan industries. Quartz microliths, obtained
through bipolar debitage on anvil, are a characteristic of the West African
techno-complex according to Kevin MacDonald. Bifacially retouched arrowheads, in
contrast, are specific for Saharan production." [see: Human population
and paleoenvironment in West Africa]
"The eighth millennium (Phase 2 of the Holocene in Ounjougou):
The subsequent Holocene sequence is well documented by two principal sites, the
Ravin du Hibou and Damatoumou. The archaeological levels can be quite clearly
chronologically placed by means of a date obtained through OSL measurements
(9420±410 Ka) and seven radiocarbon dates (between 8000 and 7000 BC cal). The
lithic industry, exclusively quartz, is characterised by unidirectional,
bidirectional and peripheral debitage, as well as by bipolar on anvil. There are
essentially microlithic tools: perçoirs, backed points, notched pieces,
denticulates, scrapers, retouched flakes and geometric microliths. Some small
bifacially retouched arrowheads were also found on those sites. At the Ravin du
Hibou, seven sherds have been found during excavation. They are heavily
fragmented and thus preventing the reconstruction of the form of the vessels.
Quartz has always been used as a temper. In just a single case, grog has been
used in addition. Two shards show identifiable decorations. Two different
techniques have been used: A rolled impression, possibly made with a peigne
fileté souple or with a cordelette, and a simple comb impression. There were
also seed grinding implements discovered at the Ravin du Hibou, a fragment of a
seed grinding stone and a cylindrical upper grinding stone." [see:
Human population and paleoenvironment in West Africa]
By about 8,000 BCE: Great lakes formed in Niger Bend, Lake Chad and Upper
Nile regions. Spread of 'African aquatic culture' through this 'great lakes'
region. Sedentary fishing communities using pottery and microlithic tools become
established long the shores of lakes and rivers. Saharan region enjoys
savanna-type climate. Favorable conditions lead to population growth.
9,000 to 6,000 BCE: Saharan region in its wettest phases.
By 6,000 BCE: Evidence of domesticated 'humpless' cattle in the Saharan
region. Also seed-cropping (or harvesting) of grains.
*ca. 8.2ky ago ~ 6,200 BC [See: Arredi et al. 2004, and also Semino et
al. 2004, and Luis et al.; Nile Valley corridor vs. the African
Horn]—Proto-Tamazight (Proto-“Berber”) common recent ancestor arose in the
vicinity of eastern Sahara-Sahel region, likely in the vicinity of where modern
Upper Egypt/Sudan general region lie. [Notes on this will follow shortly -
below]
6,000-2,500 BCE: Spread of predominantly cattle-raising peoples
throughout the Sahara.
Probably ancestral to modern-day Berber groups.
By the 5,000 BC and 2,000 BC: The bifacially retouched arrowheads are
exclusively made of quartzitic sandstone. Typologically, they can be associated
to Saharan ones. These are usually very rarely found south of the Sahara, and
give evidence of a North/South contact. Two phases can be distinguished: a first
around the fifth millennium BC, and a second around the third and second
millennium BC. The latter evidence of contact between the Sahara and sub-Saharan
West Africa is most likely linked to the beginning of the current arid phase.
The analysis of the tools and debitage waste showed that it was a very
specialized workshop. Only bifacially retouched arrowheads were produced. The
entire chaîne opératoire could be reconstructed. [see: Human population and
paleoenvironment in West Africa]
Between 4000 BC and 1000 BC: At Tichitt-Walata—"Before 2000 BC,
what is today the southern Sahara was inhabited by significant numbers of
herders and farmers. On the rocky promontories of the Tichitt-Walata (Birou) and
Tagant Plateaus in modern day Mauritania, they built what are considered among
the earliest known civilizations in western Africa. Composed of more than 400
stone masonry settlements, with clear street layouts, some settlements had
massive surrounding walls while others were less fortified. In a deteriorating
environment, where arable land and pasturage were at a premium, the population
grew and relatively large-scale political organizations emerged - factors which
no doubt explain the homogeneity of architecture, settlement patterns, and
material culture (e.g., lithic and ceramic traditions). This agro-pastoral
society traded in jewelry and semi-precious stones from distant parts of the
Sahara and Sahel, while crafts, hunting, and fishing were also important
economic pursuits...Their elites built funerary monuments for themselves over a
period extending from 4000 to 1000 BC." [sources: see Ray A. Kea, and Mauny,
R. (1971), “The Western Sudan” in Shinnie: 66-87. Monteil, Charles (1953),
“La Légende du Ouagadou et l’Origine des Soninke” in Mélanges
Ethnologiques (Dakar: Bulletin del’Institut Francais del’Afrique Noir)]
by ca. 3,000 BC the Saharan region enters into desiccation.
By 3,000 BC: Evidence of iron working and production in West Africa.
"In fact, only in Africa do you find such a range of practices in the
process of direct reduction [a method in which metal is obtained in a single
operation without smelting],and metal workers who were so inventive that they
could extract iron in furnaces made out of the trunks of banana trees,"
says Hamady Bocoum, one of the authors. [references: The Origins of Iron
Metallurgy in Africa, 2002; "Iron Roads in Africa" project c/o UNESCO]
3,000 to 1,000 BCE: Farming spreads through the former fishing belt of
the tropical woodland savannas and forest margins of West Africa. This Guinea
Neolithic era saw the domestication of millet, rice, sorghum, yams, and palm
trees among others.
From ca. 3,000 BCE: Proto-Bantu speakers having originated in the
Nigerian-Cameroon border region expand to the equatorial forests of the Congo
region. There were supposedly two streams of this expansion: Presumably the
western [and earlier movement] stream and the eastern one.
After 2,500 BCE: Saharan region enters a period of rapid desertification,
driving people and larger game animals to seek better watered lands to the north
and south for habitation. Neolithic settlements spread along the Saharan
borderlands and near rivers and lakes in the West.
1,200 to 700 BCE: Excavations at Dar Tichitt (modern Mauritania) reveal
progression from large, un-walled lakeside villages to smaller walled hilltop
villages in response to drier climate and increasing pressure from nomads.
By ca. 3ky ago ~ 1st millennium BC : the Tamazight/“Berber” groups
who were already inhabiting parts of coastal Northeast Africa, likely in the
Siwa region, had moved westward to where modern Libya and Tunisia lie. [Luis et
al.: older expansion ages of E-M81 lineages in Egypt compared to that observed
in coastal northwest African Tamazight speakers] Movements also from the
Tamazight-speaking groups in Saharan region to coastal north Africa during this
period should not be ruled out.
After 2,000 BCE: Favorable climatic conditions and developing technology
and socio-cultural systems lead to population growth in the Niger valleys.
Neolithic farming spreading south and east from the area of modern-day Cameroon.
Probably associated with speakers of proto-Bantu languages.
After 500 BCE: Height of the civilization known as Nok, which produced
art work ancestral to that of later Yoruba and lgbo peoples.
"By" 250 BC: "The earliest occupants of Jenne-Jeno (c.
250 BC - 50 AD) possessed iron and had a subsistence base that was predominantly
aquatic, e.g. waterfowl and fish, although bovids are also found that are
possible those of the domestic Bos taurus (McIntosh & McIntosh 1981:
15" - courtesy of Mikey Brass
By 2 to 2.3ky ago ~ ca. 1st cent. BC to 300 BC : Expansion of coastal
Northwest African Tamazight/"Berber" speakers in the westernmost
region of coastal Northwest Africa occurs. [Morocco/Algerian vicinity][see Luis
et al., 2004]
WEST AFRICA: C. 800 BCE TO 1591 AD/CE
By 800 BCE Neolithic agricultural peoples inhabit the best lands of the
savanna and forest margins. Regional trade networks based on the exchange of
salt, fish, pottery, and other regional specialties developing. Small,
clan-based villages typical of agricultural areas. Nomads dominate in the drier
areas.
—800 to -500 Development of Carthage in the north stimulates exchanges
of products across the Sahara Desert, managed by desert Berbers using horses,
oxen and chariots. Iron use spreads into the region from the north or east, or
both. Larger scale settlements appearing in southern Mauritania. the middle
Niger River basin, and the Jos plateau region. These areas correspond
respectively to the probable ancestral homes of the modern Soninke (northern
Mande); Songhai; and Yoruba peoples.
—500 to -200 Iron use spreads rapidly throughout West Africa,
stimulating population growth, trade, and urbanization. Iron-age peoples of Nok
(modern Nigeria) produce magnificent terracotta sculptures stylistically
ancestral to later Yoruba and Benin art. Indirect trade continues across
increasingly well-marked Saharan trails, still traversed by horse or ox-drawn
vehicles.
—200 BC t0 the 2nd A.D. The Ghana/Wagadu Heartland
The historical importance of the Tichitt-Tagant complex and the Mema district
derives from the development of the Ghana/Wagadu state organization in the area,
probably between the 2nd century BC and the 2nd century A.D. Together
with the Hodh and Awkar districts, they formed the kingdom’s heartland for
more than a thousand years (see fig 7) (cf. Robert-Chaleix 1989: 264). With a
few exceptions, the first millennium A.D. was a time of fairly continuous and
political consolidation of the system in its struggles with Kawkaw/Gao
formation, on the one hand, and the Anbiya/Sanhaja formation in the WS, on the
other.… - by Ray A. Kea, Department of History, University of
California at Riverside, 2004.
—800 to +200 Era of Nok civilization. Bantu expansion 'takes off' to
the south and east. Earliest towns, such as Jenne, growing up along the Niger on
its most northerly stretch.
—100 to +100 Camel use reaches the western Sahara via Berbers living in
its southern reaches.
—c.100 to 400 CE: Camel using Saharan Berber peoples, such as the Taureg
and Sanhaja, develop trans-Saharan trade routes, linking the Maghrib and West
Africa directly for the first time. Salt, copper, gold, dates, slaves,
agricultural produce, manufactured goods and ivory among the goods exchanged.
Soninke-led Ghana, Songhai-led Gao grow as middlemen for the expanding commerce.
Trade routes also link Nigeria and Lake Chad to North Africa.
*On a side note: "The historical records of Ghana come from Arab sources
dating between 800 and 1650 AD, but Ghana had been in existence for long before
then and was centred in the present-day Sahel region of south-eastern Mauritania
and western Mali. (Munson 1980: 457)" — courtesy of Mikey Brass
Truth is, Ghanaian complex actual age is still obscure, but by 100 CE it was
already in place.
—400 to 900 Ghana, with its capital at Kumbi Saleh, becomes the first
regional "great power." With their control over the southern end of
the trans-Saharan trade and the northern end of the gold trade, the Ghana of
Wagadu can afford the cavalry necessary to enforce his rule throughout the lands
between the Niger and the Senegal Rivers. The trans-Saharan boom stimulates the
growth of regional trade in copper, iron and other goods, both agricultural and
manufactured.
—750 to 1000 Muslim merchants from the North become a major force in
trans-Saharan and West African commerce. Islam spreads to Takrur and Ghana.
Among the Kanuri of Lake Chad, the Sefawa family founds a dynasty who will rule
Kanem for a thousand years. The trans-Saharan trade grows rapidly along with the
expansion of the Islamic world. Artists of Igbo Ukwu in southern Nigeria produce
fine works in bronze.
—ca.1000 Foundation of Ife, the political and spiritual capital of the
Yoruba.
—1054 to 1070 Almoravid Sanhaja establish control over trans-Saharan
routes from the borders of Ghana to Morocco, greatly weakening Ghana.
—ca.1085: Almoravids arrive and subsequently take control in the
Iberian peninsula, initiating African-Islamic control of the region
—11th & 12th c. Several Sudanic kings convert to Islam. Commerce in
the Sudan gradually comes to be dominated by Muslims, both of local and north
African origin.
—13th c. Rise of Mali under the great Mande hero, Sundiata Keita. Ghana
incorporated into the new great power. From its new capital at Niane on the
Niger, Mali develops trade with the developing gold fields of the Akan in
modern-day Ghana.
—14th c Empire of Mali dominates the Western half of West Africa,
controlling the gold and salt trade; promoting Islam; and providing peace and
prosperity to its region. Mansa Musa, the best known ruler of Mali, made the
pilgrimage to Mecca.
—15th c. Mali suffers dynastic difficulties and economic challenges as
the gold fields move further south and east. Songhai gains strength. Portuguese
merchants begin trading directly with the Akan along the coast of modern Ghana.
—16th c. Songhai, with its capital at Gao replaces Mali as the imperial
power of West Africa. Islamic learning flourishes with government patronage in
the university town of Timbuktu.
—1591 Moroccan troops armed with guns cross the desert and defeat the
army of Songhai, which break apart within a short time afterwards...
VARIOUS OTHER CHRONOLOGICALLY LAID OUT SITUATIONS TRANSCENDING WEST AFRICA
The following extract from Fred Wendorf & Romuald Schild (Evolutionary
Anthropology 3(4), 1994)
[Note: The references and diagrams are not included. Please consult the original
article]
[ca. 11ky - 12ky BP]
Early Neolithic
Radiocarbon dates indicate that the early Holocene rains began sometime
before 10,000 B.P., perhaps as early as 11,000 or 12,000 B.P. However, there is
no evidence of human presence before 9,500 B.P. except for a radiocarbon date of
around 10,000 years ago from a hearth west of Dakhla. The earliest sites with
large bovid remains are imbedded in playa sediments that overlay several meters
of still older Holocene playa deposits.
All of these sites contain well-made, bladelet-based lithic assemblages.
Straight-backed pointed bladelets, perforators, and large endscrapers made on
reused Middle Paleolithic artifacts are the characteristic tools. A few grinding
stones and rare sherds of pottery also occur. The pottery is well made; the
pieces are decorated over their entire exterior surfaces with deep impressions
formed with a comb or wand in what is sometimes referred to as the Early
Khartoum style.
[ca. 8,200y - 9,500y BP]
These assemblages have been classified as the El Adam type of the Early
Neolithic. Several radiocarbon dates place the complex between 9,500 and 8,900
B.P. There is no evidence that there were wells during this period. It is
assumed, then, that these sites represent occupations that took place after the
summer rains and before the driest time of the year when surface water was no
anger available. Three of these sites, E-77-7, E-79-8, and E-80-4, all having
only El Adam archeology and all located between km and 250 km west of Abu Simbel,
have yielded, through excavation, more than 20 bones and teeth of large bovids
that have been identified as Bos. These occurred along with several hundred
bones of gazelle (Gazella dorcas and G. dama) and hare (Lepus capensis); a few
bones of jackal (Canis aureus), turtle (Testudo sp.); and birds (Otis tarda and
Anas querquedula); the large shell of a bivalve (Aspatharia rubens), probably of
Nilotic origin; and various snail shells (Bulinus truncatus and Zoorecus
insularis).
After a period of aridity around 8,800 years ago, when the desert may have
been abandoned, the area was re-occupied by groups with a lithic tool-kit that
emphasized elongated scalene triangles. The grinding stones, scrapers, and rare
pieces of pottery that are present characterize the El Ghorab type of Early
Neolithic and have been dated between 8,600 and 8,200 B.P. Oval slab-lined
houses occur during this phase; all of them located in the lower pans of natural
drainage basins. However, there are no known wells, suggesting that the desert
still was not occupied during the driest part of the year. Faunal remains are
poorly preserved in these sites and indeed, only one bone of a large bovid was
recovered from the four sites with fauna in these sites the Dorcas gazelle is
the most numerous, followed by hare, together with single bones of wild cat (Felis
silvestris), porcupine (Hystrix cristata), desert hedge-hog (Paraechinus
aethiopicus) an amphibian, and a bird.
[ca. 7,900y - 8,200k BP]
Another brief period of aridity be-tween 8.200 and 8,100 B.P. coincides with
the end of the El Ghorab type of Early Neolithic in the desert. With the return
of greater rainfall between 8.100 and 8+000 B.P., a new variety of Early
Neolithic, the El Nabta type, appeared in the area. El Nabta sites are often
larger than the previous Early Neolithic sites and usually have several large,
deep wells, some with adjacent shallow basins that might have been used to water
stock. A variety of lithic and bone tools occur in these sites, including
stemmed points with pointed and retouched bases, perforators, burins, scrapers.
notched pieces, bone points, and scalene triangles measuring about one
centimeter. Grinding stones and shreds of pottery are more numerous than in the
earlier sites, but still are not abundant. Their deeply impressed designs are
similar to those on objects recovered from sites of the El Adam and El Ghorab
types of Early Neolithic. Occasional pieces have "dotted wavy line"
decoration.
Radiocarbon dates place the El Nabta sites between 8,100 and 7,900 B.P. One
of these, E-75-6, is much larger than the others and consists of a series of
shallow, oval hut floors arranged in two, possibly three, parallel lines. Beside
each house was one or more bell-shaped storage pits; nearby were several deep
(2.5 m) and shallow (1.5 m) water-wells. This site, located near the bottom of a
large basin, was flooded by the summer rains. The houses were repeatedly used,
probably during harvests in fall and winter Several thousand remains of edible
plants have been recovered from these house floors. They include seeds, fruits,
and tubers representing 44 different kinds of plants, including sorghum and
millets. All of the plants are morphologically wild, but chemical analysis by
infrared spectroscopy of the lipids in the sorghum indicates that this plant may
have been cultivated. Of the four El Nabta sites that have yielded fauna, two
contained bones of a large bovid identified as Bos. The faunal samples from the
other two sites are very small.
[ca. 7,700y - 6,500y BP]
Middle Neolithic
Another brief period of aridity separated the El Nabta Early Neolithic from
the succeeding Middle Neolithic, which is marked by the much greater abundance
of pottery. In addition, each piece of pottery is decorated over its entire
exterior surface with closely packed comb- or paddle-impressed designs. Some of
the pots are large, and analysis of the clays indicates that they were made
locally. There were also some changes in lithic tools. More of them were made of
local rocks, but there was sufficient continuity in lithic typology to suggest
that the preceding Nabta population was also involved.
Radiocarbon dates indicated an age for the Middle Neolithic between 7,700 and
6,500 B.P. The sites from the early part of this period range from one or two
house homesteads in some of the smaller playas to multi-house villages in the
larger basins. There is also one very large settlement along the beach line of
the largest playa in the area, as well as, small camps on the sandsheets and the
plateaus beyond the basins. This variation in site size has been interpreted as
reflecting a seasonally responsive settlement system in which the population
dispersed into small villages in the lower pans of the basins during most of the
year, particularly the dry season, then, during the wet season, aggregated into
a large community along the edge of the high-water stand of the largest playa.
Various house types are represented in the villages: some are circular and
semi-subterranean (30 to 40 cm deep), some slab-lined, and others appear to have
had walls of sticks and clay (wattle and daub). All of the sites have large,
deep walk-in wells and storage pits. Except for the small camps, most of the
sites appear to have been reused many times, with new house floors placed on top
of the silt deposited during the preceding flood.
Excavations at five Middle Neolithic sites have yielded more than 50 bones
from large bovids. Most of these bones came from the large
"aggregation" site (E-75-8) at the margin of the largest playa in the
area and from the early Middle Neolithic site E-77-l, dated before 7,000 B.P.,
which is located on a dune adjacent to another large playa. Each of the other
three Middle Neolithic sites yielded only one to three large bovid bones.
Around 7,000 B.P., the remains of small livestock (sheep or goats) appear in
several Middle Neolithic sites at Nabta. Because there are no progenitors for
sheep or goats in Africa, these caprovines were almost certainly introduced from
southwest Asia.
The faunal remains in many of these sites are extensive, including not only
the same species recovered from the Early Neolithic sites, but also lizards (Lacertilia
sp.) ground squirrel (Euxerus erythropus), field rat (Aricanthis nioloticus),
hyena (Hyaena hyaena), and sand fox (Vulpes rueppelii). One bone is from either
orstx (Oryx dammah) or addax (Addax nasosulcatus), The most nurmerous remains
are those of hare and the Dorcas gazelle. Nevertheless, the paucity of the fauna
and the absence, except for cattle and small livestock, of animals that require
permanent water suggests a rather poor environment, most likely comparable to
the northernmost Sahel today with about 200 mm of rain or less annually.
The Middle Neolithic was brought to an end by another major but brief period
of aridity slightly before 6,500 B.P., when the water table fell several meters
and the floors of many basins were deflated and reshaped, The area probably was
abandoned at this time.
[ca. 6,500y - 5,300y BP]
Late Neolithic
With the increase in rainfall that began around 6,500 years ago. human groups
again appeared in the area, but this time with ceramic and lithic traditions
that differed from those of the preceding Middle Neolithic. This new complex,
identified as Late Neolithic, is distinguished by pottery that is polished and
sometimes smudged on the interiors. This pottery resembles that found in the
slightly later (about 5,400 or, possibly, 6,300 B.P.) Baderian sites in the Nile
Valley of Upper Egypt. [12, 13] It seems likely that an as yet undiscovered
early pre-Badarian Neolithic was present in that area and either stimulated or
was the source of the Late Neolithic pottery in the Sahara. It is unlikely,
however, that this hypothetical early Nilotic Neolithic will date much earlier
than 6,500 B.P. There are terminal Paleolithic sites along the Nile that are
dated to around 7,000 B.P. and it is highly improbable that two such different
life-ways could co-exist exist for long in the closely constrained environment
of the Nile Valley.
Late Neolithic sites in the Egyptian Sahara consist mostly of numerous
hearths representing many separate episodes of occupation. The hearths are long
and oval, dug slightly into the surface of the ground, and filled with charcoal
and fire-cracked rocks. No houses are known. Most of the sites are dry-season
camps located in the lower parts of basins that were flooded by the seasonal
rains. Many of the sites are associated with several large, deep wells.
Many of the Late Neolithic tools are made on "side-blow flakes"
that have been retouched into denticulates and notched pieces There are also a
few bifacial arrowheads, often with tapering stems, or, rarely with concave
bases similar to those found in the Fayum Neolithic where they date between
6,400 and 5,7OO years ago. The end of the Late Neolithic in the Eastern Sahara
is not well established.The period may have tasted until around 5,300 B.P. when
this part of the Sahara was abandoned.
Due to poor preservation faunal remains in Late Neolithic sites are not as
abundant as those from the Middle Neolithic. However, the Late and Middle
Neolithic samples generally include the same animals suggesting that the
environment was also generally similar during these periods. Although large
bovids are also present in three Late Nealithic sites, and more frequently than
in the faunal assemblages of the preceding period, they still are a minor
component of the sample.
The Late Neolithic Nabta is marked by interesting signs of increased social
complexity, including several alignments of updght slabs (2 x 3 m) imbedded in,
and sometimes almost covered by, the playa sediments. Circles of smaller uptight
stabs may calendrical devices. Stone-covered tumuli are also present; two of the
smaller ones contain cow burials, one in a prepared and sealed pit. none of the
more than 30 large tumuli thus far located, which are by large, roughly shaped
blocks of stone, has been excavated.
Even the earliest of these early Holocene Eastern Sahara sites have been
attributed to cattle pastoralists. It is presumed that these Early Neolithic
groups came into the desert from an as yet unidentified area where wild cattle
were present and the initial steps toward their domestication been taken.
This area may have been the Nile Valley between the First and Second
Cataracts, where wild cattle were present. Moreover, lithic industries were
closely similar to those in the earliest Saharan sites. It has been suggested
that cattle may have facilitated human use of the Sahara by providing a mobile,
dependable, and renewable source of food in the font of milk and blood. The use
of cattle as a renewable resource rather than for meat is seen as a possible
explanation for the paucity of cattle remains in most of the Saharan sites. Such
use in a desert, where other foods were so limited, may have initiated the
modern East African pattern of cattle pastonlism in which cattle are important
as a symbol of prestige, are primarily used for milk and blood, and rarely are
killed for meat.
It is assumed, because of the apparrent absence of wells at the earliest
sites, that the first pastoralists used the desert only after the summer rains,
when water was still present in the larger drainage basins. After 8,000 years
ago, when large, deep wells were dug, the pastoralists probably resided in the
desert year-round.
**Linguistic evidence**
In addition to the archeological and paleontological evidence, recent
linguistic studies indicate the presence of early pastoralists in the Eastern
Sahara. Detailed analysis of Nilo-Saharan root words has provided
"convincing evidence" that the early cultural history of that language
family included a pastoralist and food producing way of life, and that this
occurred in what is today the south-western Sahara and Sahel belt.
The Nilo-Saharan family of languages is divided into a complex array of
branches and subgroups that reflect an enormous time depth. Just one of the
subgroups, Kir is as internally complex as the lndo-European family of languages
and is believed to have a comparable age. The Sudanese branch is of special
interest here. This is particularly true of the Northern Sudanese subfamily that
includes a Saharo-Sahelian subgroup, the early homeland of which is placed in
northwest Sudan and northeast Chad. Today, the groups that speak Saharo-Sahelian
are dispersed from the Niger river eastward to northwestern Ethiopian highlands.
The Proto-Northern Sudanic language contains root words such as
"to drive," "cow, "grain,""ear of grain," and
"grindstone." Any of these might apply to food production, but another
root word meaning "to milk" is cetainly the most convincing evidence
of incipient pastoralism.
There are also root words for "temporary shelter" and "to make
a pot." In the succeeding Proto-Saharo-Sahelian language, there are root
words for "to cultivate", "to prepare field", to
"clear" (of weeds), and "cultivated field." this is the
first unambiguous linguistic evidence of cultivation. There are also words for
"thombush cattle pen," "fence," "yard," "grannary,"
as well as "to herd" and "cattle." In the following Proto-Sahelian
period, there are root words for "goat," "sheep,"
"ram," and "lamb," indicating the presence of small
livestock.
There are root words for "cow," "bull," "ox,"
and "young cow" or "heifer" and, indeed, a variety of terms
relating to cultivation and permanent houses.
On the basis of known historical changes in some of the language, Ehret
estimates that the Proto-Northern Sudanic language family, which includes the
first root words indicating cattle pastoralism, should be dated about 10,000
years ago. He also estimates that the Proto-Saharan-Sahelian
language family, which has words indicating not only more complex cattle
pastroalism, but the first indications of cultivation, occurred around
9,000 years ago. He places the Proto-Sahelian language at about 8,500
years ago.
These age estimates are just that, and should not be used to suggest any
other chronology. Nevertheless, the sequence of cultural changes is remarkably
similar to that in the archeology of the Eastern Sahara and, with some minor
adjustments for the beginning of cultivation and for' the inclusion of
"sheep" and "goat," reasonably closely to the radiocarbon
chronology.
Evidence from other parts of North Africa
The antiquity of the known domes-tic cattle elsewhere in North Africa does
not offer much encouragement with regard to the presence of early domestic
cattle in the Eastern Sahara. Gautier recently summarized the available data,
noting that domestic cattle were present in coastal Maurita-nia and Mali around 4,200
years ago and at Capeletti in the mountains of northern Algeria about
6,500 years ago. At about that same time, they may have been present in
the Coastal Neolithic of the Maghreb. Farther south in the Central Sahara,
domestic cattle were present at Meniet and Erg d'Admco, both of which date
around 5,400 years ago, and at Adrar Rous, where a complete skeleton of a
domestic cow is dated 5,760 +/- 500 years B.P ].
Domestic cattle have been found in western Libya at Ti-n-torha North and Uan
Muhuggiag, where the lowest level with domestic cattle and small livestock
(sheep and goats) dated at 7,438 t 1,200 B.P. At Uan Muhuggiag, there is also a
skull of a domestic cow dated 5,950 +/- 120 years. In northern Chad at Gabrong
and in the Serir Tibesti, cattle and small livestock were certainly present by
6,000 B.P. and may have been there as early as 7,500 B.P. We are skeptical,
however, about the presence of livestock at Uan Muhuggiag and the Serir Tibesti
before 7,OO0 B.P., when small livestock first appear in the Eastern Sahara, if
we must assume that these animals reached the central Sahara by way of Egypt and
the Nile Valley. This also casts doubt on the 7,500 B.P. dates for cattle in
these sites.
The earliest domestic cattle in the lower Nile Valley have been found at
Merimda, in levels that have several radiocarbon dates ranging between 6,000 and
5,400 B.P. and in the Fayum Neolithic, which dates from 6,400 to 5, 400 B.P.
These sites also have domestic pigs and either sheep or goats. In Upper Egypt,
the earliest confirmed domestic cattle are in the Predynastic site of El
Khattara, dated at 5,300 B.P. However, domestic cattle were almost
certainly present in the earliest Badarian Neolithic, which dates before 5,400
B.P. and possibly were there as early as 6,300 B.P. Farther south,
in Sudan near Khartoum, the first do-mestic cattle and small livestock oc-curred
together in the Khartoum Neolithic, which began around 6,000 B.P.
It is probably significant that none of the early Holocene faunal
assemblages in the Nile Valley from the Fayum south to Khartoum
that date between 9,000 and 7,000 B.P. contains the remains of
cattle that have been identified as domestic It is this absence of any evidence
of recognizable incipient cattle domestication in the Nile Valley or elsewhere
in North Africa that cautions us to consider carefully the evidence of early
domestic cattle in the Eastern Sahara.
...By employing the method of "strong inferences," which involves
formulating alternative hypotheses, testing them to exclude one or more, arid
adopting those that remain, we have concluded that domestic cattle
probably were present in the Eastern Sahara as early as 9,000 years ago and,
perhaps earlier. At the same time, we recognize that there is no such
thing as proof and that science advances only by disproofs. Future evidence may
suggest a better hypothesis or indeed, this controversy may be conclusively
resolved if DNA testing now under way determines that the Bos remains found in
African and Southwest Asian archaeological sites belong to the same closely
related gene pool or that they represent two populations that have been
separated for many thousands of years. Until then, Gautier's hypothesis of
domestic cattle in the Eastern Sahara during the Early Holocene remains
reasonable, if insecure.
Link: www.antiquityofman.com/cattle_domestication_wendorf1994.html
Speaking of DNA...
Non-human DNA has great potential for shedding light on cultural practices.
Recent work by Daniel Bradley is a case in point. Before now it was
assumed that cattle were first domesticated in the Near East. African,
European, and Indian cattle were all thought to be descended from a
domesticated Near Eastern progenitor, and to have developed into
characteristic breeds afterward. Bradley and his colleagues have determined
that Indian cattle broke off from an ancestral lineage between 117,000
and 275,000 years ago. The lineage split again about 22,000to 26,000
years ago into groups that gave rise to modern African and European cattle.
These are startling results because cattle in the Near East were not
domesticated until about 9,000 years ago, and cattle in India and
Africa were genetically distinct before then. The latter two could not
possibly be descended from domesticated Near Eastern cattle, as was
thought, but must have been domesticated independently. - Courtesy
Archaeological Institute of America, 1996.
MONSOON rain, or rather the lack of it, precipitated the rise of great
civilisations in what is now the Sahara desert.
Extracts by Emma Young
Since prehistoric times people have been following the shifting monsoon rains
around the Sahara, a practice that triggered the herding of livestock and even
the development of the great pharaonic dynasties, say researchers who have
re-examined archaeological sites across the region.
Rudolph Kuperand Stefan Kröpelin of the Institute of Prehistoric
Archaeology at the University of Cologne, Germany, studied geological and
ecological data for clues to patterns of past rainfall. They also examined
radiocarbon dates of dwellings and artefacts from 150 archaeological sites
stretching from the far north of the eastern Sahara to the south, which allowed
them to identify four main phases of human occupation of the desert (Science,
DOl: 10.1126/science.1130989).
c.10.5ky ago ~ 8,500 BC to 7.5ky ago ~ 5,500 BC:
Starting around 8500 BC, and continuing over the next few centuries, the
lower boundary of the desert shifted about 800 kilometres north, bringing
monsoon rains to barren lands. People living in the south followed the rains
north, rapidly occupying the entire eastern Sahara. For about the next 3000
years, the climate was relatively stable. During this time, human settlements
became well established, and people began to keep livestock.
c.7.3ky ago ~ 5300 BC:
Then, around 5300 BC, monsoons failed to reach the Egyptian Sahara. People
began to retreat, along with their cattle, into places such as the banks of the
Nile where there was still enough rainfall and surface water to meet their
needs. "We are convinced that the emergence of the pharaonic civilisation
in the Nile Valley in about 3500 BC was not coincidental - but triggered by the
onset of full desert conditions in most of Egypt outside the Nile valley and a
few oases," Kropelin says.
c.5.5ky ago to c.3.5ky ago ~ 3500 and 1500 BC:
Finally, between 3500 and 1500 BC, lack of rain drove people to
maintain permanent settlements in the south of the region only. This exodus
introduced the Neolithic way of life into sub-Saharan Africa, including
pastoralism - and even today keeping livestock is one of the most important
African economies.
Source: By Emma Young - Copyright Reed Business Information UK Jul 29-Aug 4,
2006
Courtesy of metmuseum.org, we have:
814 B.C. Tradition preserves this date as the year in which Phoenician
colonists from the Levant establish the city of Carthage on the coast of
modern-day Tunisia. The native peoples are hostile to the Phoenicians and
require tribute, such as rent on their land, through the fifth century
B.C. With the decline of Phoenician power and the destruction of Tyre in the
sixth century B.C., Carthage emerges as a trading center in its own right.
• ca. 500 B.C. Carthaginian ships carry metals, oil, wine, grain,
and other products to ports throughout the western Mediterranean. In order to
protect their mercantile interests, they establish trading posts in Sicily and
Sardinia and on the southern coast of modern France. Competition for control of
shipping leads them into sporadic armed conflict with Greek and Etruscan forces.
Through trade, Carthage emerges as one of the richest and most powerful cities
in the Mediterranean. Objects made in Carthage reflect artistic styles imported
from the Near East, Etruria, Egypt, and the Greek city-states. Among the luxury
goods manufactured here are perfume, glassware, ivory carvings, fine
woodwork, and precious purple dye.
• 264 B.C. Rome, which has subdued its Greek and Etruscan neighbors,
continues an expansion that threatens Carthaginian trade concerns. The First
Punic (Carthaginian) War breaks out, with many major battles fought on sea. In
241 B.C., peace is declared, and the Carthaginians are forced to pay a large
indemnity to Rome. Hamilcar Barca, commander of the Carthaginian army, goes to
Spain in 237 B.C. and begins to conquer territory along the Mediterranean coast,
ostensibly to raise money for the indemnity. In Hamilcar's entourage is
his nine-year-old son Hannibal.
• 238 B.C. Masinissa becomes king of the united Numidian tribes. The
many groups of Numidian nomads had begun to confederate in the third century
B.C. Masinissa encourages settled agriculture, urban developments, and
Carthaginian customs.
• 218 B.C. Hannibal (247–183 B.C.), commander of the Carthaginian
forces, leads his troops from Spain through the passes of the Pyrenees and Alps
into Italy. With him are thirty-seven elephants of war. These events mark the
outset of the Second Punic War, another long campaign that drains the strength
not only of Rome and Carthage but also of the Greek-speaking kingdoms in the
eastern Mediterranean. The Roman general Scipio Africanus eventually destroys
Hannibal's forces at Zama, North Africa, in 202 B.C., and the Roman terms
of peace dismember the Carthaginian empire. Hannibal continues to scheme against
the Romans until his death, perhaps by suicide, in 183 B.C.
• 149 B.C. Despite defeat, Carthage regains its economic strength.
New buildings are raised, including a residential quarter. Recovery in Carthage
causes anxiety in Rome. The Romans send an army to besiege the city. When it
surrenders in 146 B.C., the Romans wreak merciless destruction, leveling the
once proud city, enslaving the people, and cursing the very ground against any
subsequent habitation.
• ca. 140 B.C. A richly colored marble, called giallo antico in the
Renaissance, is first quarried in Chemtou (in present-day Tunisia). The
characteristic color of Chemtou marble is a golden yellow, but it also contains
streaks of rose, blood red, and green. The quarries, first operated by the
Numidian kings and later by the Roman emperors, supply stone for lavish
building enterprises throughout the Mediterranean, including the Forum of
Augustus (ca. 12 B.C.) and the Pantheon (ca. 130 A.D.) in Rome.
• 46 B.C. The Numidian kingdom comes to an end under Juba I, who
entered the fierce civil wars among the Romans on the side of Pompey, defeated
by Julius Caesar. Receptive to both Carthaginians and Hellenistic Greek customs,
the Numidians had splendid palaces in the Hellenistic style, Greek philosophers
to counsel them, and temples dedicated to the Phoenician god Baal Hammon,
sometimes assimilated into the Greek Zeus. In Caesar's triumphal procession,
resplendent booty worthy of Numidian wealth and taste is paraded through the
streets of Rome, along with Juba II, infant son of the defeated king.
• 25 B.C. Augustus, who emerges victorious at Rome after a century
of war, grants Juba II the client kingship of Mauritania. His domain
corresponds to a portion of the former Numidian kingdom. Reared at Rome, Juba II
is a man of extraordinary learning, a collector and a patron of the arts. He
marries Cleopatra Selene, daughter of the great Cleopatra defeated by Augustus.
Copies of Greek statues adorn his palace, and he authors several volumes in
Greek on a wide range of subjects, including a history of Rome, the antiquities
of various nations, and research on language and the theater.
...
• 11th century The Sefawa dynasty establishes a capital at Njimi and
controls the trade in ivory, ostrich feathers, and slaves.
• 11th–15th/16th century Resisting conversion to Islam, Tellem people
migrate from the Inland Niger Delta and Jenne-Jeno to the Bandiagara Escarpment.
• ca. 1180–1230 Under the Kante dynasty, the Soso kingdom expands to
absorb much of ancient Ghana.
• ca. 13th century A clan breaks away from the troubled dynasties of
the Kanem kingdom in central Sudan. Settling to the southwest of Lake Chad, this
splinter population becomes the Borno kingdom. In the fifteenth century, Borno
establishes trade links with the Hausa, supplying salt and horses in exchange
for Akan gold. The Hausa are peoples born of the encounter between southern
Saharan nomads and local mixed farmers of the northern Nigerian savanna.
• ca. 13th century Muslim Soninke found the city of Jenne in the Inland
Niger Delta, a site that will grow to become one of the most famous centers in
the region. (Oral tradition maintains that Jenne was established much earlier,
during the eighth century.) The Great Mosque is dedicated around this time by
Koi Konboro, the twenty-first king of Jenne and the first to convert to Islam.
Politics dictate that the mosque be rebuilt more than once, and its original
appearance is no longer certain. The remarkable adobe mosque that stands there
today was erected in 1906–7.
...
• 1312 Mansa Kankan Musa I becomes emperor of Mali, guiding the empire
through its most prosperous years, enhancing trade, expanding borders, and
sponsoring mosques. While undertaking a spectacular pilgrimage to Mecca in
1324–25, he stops en route in Cairo, where he dispenses so much gold that the
precious metal is devalued for years. Returning to Mali in 1325, Musa is
informed that his forces have just conquered the kingdom of Gao, where he is
said to have subsequently dedicated a mosque. Djinguere Ber at Timbuktu is the
most famous mosque traditionally associated with Mansa Musa. He is represented
holding gold nuggets on a map dated to 1375, drawn in Spain.
• ca. 1352 Ibn Battuta, renowned global traveler and writer, spends
a year in Mali and records his observations. Although Mansa Musa is deceased by
this time, the empire is still vigorous. Battuta is especially impressed with
the strict order and justice enforced by the resident Malian king.
• 14th–15th century Gao and the western part of Songhai state
are brought within the boundaries of Mali during the fourteenth century. But the
greater part of Songhai remains beyond Mali's tax-collecting orbit. With the
decline of Mali in the fifteenth century, Songhai shows its independence. Under
Sonni cAli the Great (r. 1464–92), the Songhai become an empire, totally
eclipsing Mali. Sonni cAli captures Timbuktu in 1468. The Songhai empire
collapses with the Moroccan invasion of 1591.
— ca 5000 y ago - IRON IN AFRICA:
Courtesy UNESCO.org
The theory that sub-Saharan Africa borrowed its iron technology from other
cultures is no longer tenable. The fact is that the continent invented and
developed its own iron metallurgy as far back as the third millennium B.C.
Author(s) I.A. Akinjogbin, D.A. Aremu, H. Bocoum, P. de Maret, J.M. Essomba, P.
Fluzin, J.F.Jemkur, L.-M. Maes Diop, B. Martinelli, G. Quéchon, E.E. Okafor, A.
Person. Prefaced by Doudou Diène. Edited by Hamady Bocoum.
Publication Date 01 Jan 2004
REVISING THE HISTORY
24-06-2002 - Africa developed its own iron industry some 5,000 years ago,
according to a formidable new scientific work from UNESCO Publishing that
challenges a lot of conventional thinking on the subject.
Iron technology did not come to Africa from western Asia via Carthage or
Merowe as was long thought, concludes "Aux origines de la métallurgie du
fer en Afrique, Une ancienneté méconnue: Afrique de l'Ouest et Afrique
centrale". The theory that it was imported from somewhere else, which—the
book points out—nicely fitted colonial prejudices, does
not stand up in the face of new scientific discoveries, including the
probable existence of one or more centres of iron-working in west and central
Africa and the Great Lakes area.
The authors of this joint work, which is part of the "Iron Roads in
Africa" project (see box), are distinguished archaeologists, engineers,
historians, anthropologists and sociologists. As they trace the history of iron
in Africa, including many technical details and discussion of the social,
economic and cultural effects of the industry, they restore to the
continent "this important yardstick of civilisation that it has been denied
up to now," writes Doudou Diène, former head of UNESCO's Division of
Intercultural Dialogue, who wrote the book's preface.
But the facts speak for themselves. Tests on material excavated since the
1980s show that iron was worked at least as long ago as 1500 BC at Termit, in
eastern Niger, while iron did not appear in Tunisia or Nubia before the 6th
century BC. At Egaro, west of Termit, material has been dated earlier
than 2500 BC, which makes African metalworking contemporary with that of the
Middle East.
..."In fact, only in Africa do you find such a range of practices in the
process of direct reduction [a method in which metal is obtained in a single
operation without smelting],and metal workers who were so inventive that they could
extract iron in furnaces made out of the trunks of banana trees," says
Hamady Bocoum, one of the authors.
This ingenuity was praised in the early 19th century by the Tunisian scholar
Mohamed el-Tounsy, who told of travelling in Chad and Sudan and coming across
spears and daggers made "with the skill of the English" and iron
piping with "bends and twists like some European pipes, but more elegant
and graceful and shining so brightly they seem to be made of silver."
Seeking Africa's first Iron Men.
Heather Pringle
Courtesy of Science 2009.
"Now controversial findings from a French team working at the site of Ôboui
in the Central African Republic challenge the diffusion model. Artifacts there
suggest that sub-Saharan Africans were making iron by at least 2000 B.C.E. and
possibly much earlier—well before Middle Easterners, says team
member Philippe Fluzin, an archaeometallurgist at the University of Technology
of Belfort-Montbéliard in Belfort, France. The team unearthed a blacksmith's
forge and copious iron artifacts, including pieces of iron bloom and two
needles, as they describe in a recent monograph, Les Ateliers d'Ôboui,
published in Paris. "Effectively, the oldest known sites for iron
metallurgy are in Africa," Fluzin says."
...
Fumes (Augustin) Holl - "People just have this conception that iron
teechnology in sub-saharan Africa has to be later than 500 B.C.E., and when it
is earlier than that, they start looking for [alternative] explanations."
*Recalling:
ca. 11,000 BP: Archeological indicators of Yam cultivation in
west Africa in the vicinity of the Niger delta region.
Well, expanding on that a little, we have from Chris Ehret...
The story of the Guinea Coast rice farmers is simply one example of the
immense diversity of African agricultural inventiveness over the long course of
history-and a relatively late example at that. We now know that the history
of cultivation and livestock-raising in Africa extends almost 11,000 years ago.
By 8500 BCE, at about the same time as peoples in the Middle East began for the
first time to cultivate wheat and barley, African communities living more than
1,000 kilometres to the south separately and independently became the earliest
known raisers of cattle in the world.By around 7000-6000 BCE, the descendants
of these first cattle keepers started also to cultivate crops. The early staple
of their "Sudanic" agriculture was sorghum, now a crop of almost
worldwide importance (see photos, courtesy of the author).
Still another independent invention of agriculture took place in West Africa
among early inhabitants speaking languages of the Niger-Congo family. The
West African cultivation ideas are also very old, possibly dating as long ago as
9000-7000 BCE. The early staple of this agriculture was probably the Guinea
yam, but West African farmers also domesticated a number of other crops, now
well known outside Africa, including okra and black-eyed peas (cow-peas). Over
the past 4,000 years in the more western parts of West Africa, another crop,
African rice, replaced yams in importance.
Archaeology provides part of our knowledge of this history, but a great many
areas of Africa remain still poorly known to archaeologists. So, in African
historical studies, scholars have turned increasingly to linguistic
reconstruction of the past.
Source: Christopher Ehret, Implications for Agriculture and
Development
Recalling...
• 14th–15th century Gao and the western part of Songhai
state are brought within the boundaries of Mali during the fourteenth century.
But the greater part of Songhai remains beyond Mali's tax-collecting orbit. With
the decline of Mali in the fifteenth century, Songhai shows its independence.
Under Sonni cAli the Great (r. 1464–92), the Songhai become an empire, totally
eclipsing Mali. Sonni cAli captures Timbuktu in 1468. The Songhai empire
collapses with the Moroccan invasion of 1591.
Stephen
Cory of the University of California at Santa Barbara tells us about the
damaging and long term impact of the Moroccan invasion on both Morocco and
sub-Saharan West Africa's future [that is to say, West Africa's state today],
which derserves to be a topic on its own and indeed will be the subject of a
future blog posting here...
Through this study, I have sought to demonstrate the long-lasting
connections between North Africa and sub-Saharan Africa.
Although these connections existed centuries before the coming of
Islam, they grew stronger throughout the Islamic period.
During the sixteenth century, the Sa'di sultan Ahmad al-Mansur observed
the economic, cultural, and religious connections between the two regions, and
argued that there ought to be political unification between them as well.
And yet, it was at this point that things broke down, as
al-Mansur was unable to achieve his dream of a caliphate that spanned both sides
of the Sahara. The unification project for such a broad expanse of territory was
too difficult for a moderately-powerful state, lacking in sophisticated
infrastructure, such as Morocco, to achieve. Despite the existence of these many
inter-connections, they were insufficient to support political unification.
In fact, if Kaba's argument is correct, al-Mansur's attempt at integrating West
Africa into his state had long-lasting disastrous consequences for
both North and West Africa.
By destroying the strongest centralized state in sub-Saharan Africa,
al-Mansur's invasion did irreparable damage to the trans-Saharan trade
routes that had enriched both Morocco and West Africa. Instead, this trade
increasingly began to be diverted to the south, where it was accessed by
European merchants along the Gold and Slave Coasts. And the process
of devoting all of the state's efforts towards the invasion exhausted
the Sa'di dynasty, making it extremely vulnerable to outside
interference and collapse, once misfortune hit in the form of the
plague and various famines. The sons of al-Mansur tore his dynasty
apart after his death, and Morocco would never again challenge for supremacy in
the Islamic or Mediterranean worlds.
In attempting to establish a form of African political unity, al-Mansur **hastened
division and decline, leaving West Africa unprotected before the European
onslaught that was to come in the following centuries.25**
Turning to Art in the Sahara...
What to make of this diagrammatical layout of chronology?
Well, for one the authors make it clear that they
weren't able to use C14 dating*, but rather:
"It was not possible to get a radiometric age for any style: the chemical
tests on some samples of paintings did not detect enough organic material to
allow 14C dates. So we did not continue with the samplings. We have dated the
paintings on the basis of depicted weapons and texts (Fig. 11)."
...and go onto say:
"The most ancient, the Dancers’ Style, belongs to an early or medium
Bronze Age (3,800-3,200 BP), as the depiction of halberds shows. The most
recent, the Lineal Style, should be dated between 2,400 BP and the beginning of
the Christian era (or still later) because of the presence of Lybico-Berber
texts and the lack of camels. The chronology of the Shaped, Stroked and Dark
Figure styles lies between the ages of the Dancers and the Lineal styles.
Finally, there is also a unique ancient Arabic text, which might represent the
historic ages after the XVth century AD.
All but the Lineal Style depict similar subjects although not the same themes.
In the Dancers’ Style, the processions of people, which carry throwing-sticks
and seem to dance, constitute the most typical theme. There are also people with
bovines depicted and meetings in which children are also present. In the Shaped
Style, depictions of very dynamic people and very realistic bicolour antelopes
are found. In its Outlined sub-style, only antelopes, giraffes, bovines and
ostriches are depicted, always in large dimensions (more than one meter long).
The same kinds of animals and with similar sizes are depicted in the Stroked
Style in which series of giraffes are the most typical theme. In the Dark
Figures style, men, women, gazelles, elephants and small quadrupeds (maybe dogs)
are depicted. The compositions are always organized in lines of these main
subjects. The main theme is a series of small gazelles (each one being about
10cm long). Another common theme among the Dark Figures style is the hunting of
an elephant. Some bicolour gazelles longer than one meter belong to this style
too. Finally, in the Lineal Style, non-figurative images and very schematized
humans and quadrupeds are depicted. In this style, the typical pan-Saharan theme
of an ostrich hunted by two horsemen is also found. The Lybico-Berber texts
belong to this latest style.
Regarding the relation between paintings and engravings in the Western Sahara,
we think that it is possible to link a pictorial style with a style of
engravings. As the comparison of the images shows, the Dancers’ Style, the
most ancient, can be related to the Tazina Style of engravings on the basis of
the human depictions, morphologically very similar in both styles. In the
examples coming from the Wadi Ben Sacca (Milburn 1971) and the Meicateb well (Mateu
1945-46) all the figures have bent legs, always ahead of the body, and unstable
positions, with L-shaped feet and fingers on their hands. Although the following
are not strictly stylistic elements, in both cases humans carry similar weapons,
skirts and headdress too. So the research on the paintings of the Zemmur
indicates that the Tazina engravings might also be dated to the early Bronze
Age.
Discussion and conclusions
At the beginning of the research we assumed that most of the pictures belonged
to prehistoric times because they depicted elephants and rhinoceros and people
were carrying bows. We thought so because many researchers tend to use the
presence of those animals and weapons as evidence to consider these kinds of
depictions as very ancient ones, anterior to 4,000 BP. Around that period, a
progressive aridification might have begun and those researchers guess that
those animals could not live in the Western Sahara anymore. Our later research
has shown that most of the images of the Zemmur are certainly prehistoric but also
demonstrate that the use of those species as dating elements could be
misleading. It is true that many of them were extinct in the area many
centuries ago, some of them before the Christian era, as we know from the
classic and Arabic sources. But it is also true that they still lived in the
Western Sahara in the Bronze Age and later. For example, an elephant and a
rhinoceros appear in a panel with people carrying swords, which are recent
weapons.
So we must conclude that in the Western Sahara the presence of those species
does not automatically assign a date previous to 4,000 BP to the style in which
they are depicted. At least in the Western Sahara, we should not use the
depictions of those wild animals as reliable dating elements.
The depiction of some weapons like bows and throwing sticks has been used in a
similar way. In our opinion this should be avoided too, at least in the Western
Sahara, where people using throwing sticks and bows appear at the same time and
later than people carrying halberds. On the other hand, swords, spears and
shields always appear related to the most recent style, the Lineal Style,
itself related to Lybico-Berber inscriptions.
Because very few archaeological excavations have been done in the Western
Sahara, we still have no clear and safe sequence of the prehistoric cultures
that occupied the region. As a consequence, it is difficult to link any of the
rock art remains with a prehistoric culture. If we could obtain an absolute
radiometric age for any of the styles, it would still be difficult to relate it
with any cultural period or other material remains. Thus, two of the major
problems concerning the Zemmur paintings—the interpretation and
the cultural identity of their authors—still remain unresolved.
We can also conclude that most of the prehistoric painting styles of the Western
Sahara are different from those in the central Sahara. However this mainly
applies to the technical side of the styles. On the other hand, the subjects and
some themes are similar to those depicted in some Écoles du Bovidien Final (Iheren-Tahilahi,
Ouan Amil and Ti-n-Anneuin) in the central Sahara (Muzzolini 1995). The dates we
propose here for the rock-paintings of the Zemmur agree with the ones Muzzolini
proposed for the Écoles du Bovidien Final too.
Some of these newly-defined styles are found only in the Zemmur rock-shelters
but this fact could change soon as the research continues further.
Courtesy INORA Online: www.bradshawfoundation.com/inora/discoveries_45_3.html
*— Should the link be broken, refers to:
Dating art imprinted on stones, are pretty much guesses or approximations based
on carbon-dating of organic matter on and/or around the said stones and perhaps
on the material used to draw on the said stones, since apparently, the stones
themselves cannot be dated via carbon-dating.
See, for example:
The criteria of direct rock art
dating are clear, precise and rigorous. Direct
dating does not produce actual ages of rock art,
it generates testable propositions about the relevance of specific physical or
chemical data to the true age of rock art. The interpretation of the relation
demands a considerable understanding of the dating technique used; of the
circumstances of sample collection, processing and distorting factors; and of
the limitations and quite specific qualifications applying to the stated
results. None of the methods
used in direct dating of rock art produces results that can be conveyed by some
simple numerical expression, which unfortunately is how they are often quoted in
the archaeological literature.
Therefore it is fair to say that archaeologically published results of direct
dating are often presented in a misleading form. Such results should always be
understood within the context they were acquired and within which the
archaeometrists expect them to be seen (Bednarik 1996, 2000a; Watchman 1999).
Consider, for instance, the ubiquitous radiocarbon analysis results, and the way
they are misused (see Pitfalls in rock art dating).
There are very few kinds of circumstances in which a carbon-14 result can
directly be related to the age of rock art, and so
far (in 2001) no rock art has been dated by radiocarbon.
This is not what one would be
led to believe if one sifted through recent archaeological commentaries.
- Robert G. Bednarik
mc2.vicnet.net.au/home/date/web/direct.html
— ca. 100 ky ago or more, going southward...
Oldest Jewelry? "Beads" Discovered in African Cave - National
Geographic.
The presence of beads, whether used as trade items, to convey group status, or
to identify group members or relationships within a group suggests some form
of language existed, says Henshilwood, who is affiliated with the University
of Bergen, Norway, and the State University of New York.
"What the beads might symbolize is unknown, but it does imply that there
had to be some means of communicating meaning, which plausibly is
language," Henshilwood said. "Everyone knew what it meant, just as
today if you're wearing Gucci sunglasses or a diamond tennis bracelet, there's a
message being put out."
Related to the above, are topics of:
—Is Bead Find Proof Modern Thought Began in Africa?
—African Bone Tools Dispute Key Idea About Human Evolution When Did
Modern Behavior Emerge in Humans?
Continuing with the National Geographic piece, Hensilwood tells us...
Recent studies have suggested that Khoisan, a southern African language that
includes many clicks, could be as many as 100,000 years old. It's possible the
people at Blombos were speaking in some form of click language,
Henshilwood said....
Speaking of which, as the present author posted elsewhere...
As we go further back in time, it becomes clear that the Khoisan languages are
just but among the various oldest languages spoken on the continent, with traits
such as the "clicking" sound. And these populations, as it turns out,
aren't necessarily as genetically close, as one would imagine:
African Y chromosome and mtDNA divergence
provides insight into the history of click languages.
Knight A, Underhill PA, Mortensen HM,
Zhivotovsky LA, Lin AA, Henn BM, Louis D, Ruhlen M, Mountain JL.
Department of Anthropological Sciences,
Stanford University, Stanford, CA 94305, USA. [email protected]
BACKGROUND:
About 30 languages of southern Africa, spoken by Khwe and San, are characterized
by a repertoire of click consonants and phonetic accompaniments. The Jumid
R:'hoansi (!Kung) San carry multiple deeply coalescing gene lineages. The deep
genetic diversity of the San parallels the diversity among the languages they
speak. Intriguingly, the language of the Hadzabe of eastern Africa, although not
closely related to any other language, shares click consonants and
accompaniments with languages of Khwe and San.
RESULTS:
We present original Y chromosome and mtDNA variation of Hadzabe and other ethnic
groups of Tanzania and Y chromosome variation of San and peoples of the central
African forests: Biaka, Mbuti, and Lisongo. In the context of comparable
published data for other African populations, analyses of each of these
independently inherited DNA segments indicate that click-speaking Hadzabe and
Jumid R:'hoansi are separated by genetic distance as great or greater than that
between any other pair of African populations. Phylogenetic tree topology
indicates a basal separation of the ancient ancestors of these click-speaking
peoples. That genetic divergence does not appear to be the result of recent gene
flow from neighboring groups.
CONCLUSIONS:
The deep genetic divergence among click-speaking peoples of Africa and mounting
linguistic evidence suggest that click consonants date to early in the history
of modern humans. At least two explanations remain viable. Clicks
may have persisted for tens of thousands of years, independently in multiple
populations, as a neutral trait.
Alternatively, clicks
may have been retained, because they confer an advantage during hunting in
certain environments.
Source:www.bec.ucla.edu/papers/Mountain_3-7-05.pdf
Moving to the southeastern corner of the continent. In an area of Africa rarely
talked about:
Madagascar!...
ca 2000 to 1500 years ago: Movement of people from southeast Asia to the
southeast African coast, as part of the bidirectional movement of people
in the said regions, according to the following:
Migration of people from southeast Asia about 2000-1500 years ago - a mirror
image of the migrations from that region into the Pacific, to Micronesia and
Polynesia, that had occurred about 1000 years earlier.
The cryptic past of Madagascar
Human inhabitants of Madagascar are genetically unique
Half of the genetic lineages of human
inhabitants of Madagascar come from 4500 miles away in Borneo, while the other
half derive from East Africa, according to a study published in May by a UK
team.
The island of Madagascar, the largest in the Indian Ocean, lies some 250 miles
(400 km) from Africa and 4000 miles (6400 km) from Indonesia. Its isolation
means that most of its mammals, half of its birds, and most of its plants exist
nowhere else on earth. The new findings, published in the American Journal of
Human Genetics, show that the human inhabitants of Madagascar are similarly
unique - amazingly, half of their genetic lineages derive from settlers from the
region of Borneo, with the other half from East Africa. Archaeological evidence
suggests that this settlement was as recent as 1500 years ago - about the time
the Saxons invaded Britain.
"The origins of the
language spoken in Madagascar, Malagasy, suggested Indonesian connections,
because its closest relative is the Maanyan language, spoken in southern
Borneo," said Dr Matthew
Hurles, of the Wellcome Trust Sanger Institute. "For
the first time, we have been able to assign every genetic lineage in the
Malagasy population to a likely geographic origin with a high degree of
confidence."
"**Malagasy
peoples are a roughly 50:50 mix of two ancestral groups: Indonesians and East
Africans.** It is important
to realise that these lineages have intermingled over intervening centuries
since settlement, so modern Malagasy have ancestry in both Indonesia and
Africa."
The team, from Cambridge, Oxford and Leicester, used two types of DNA marker to
study DNA diversity: Y chromosomes, inherited only through males, and
mitochondrial DNA, inherited only through females. They tested how similar the
Malagasy were to populations around the Indian Ocean. The set of non-African Y
chromosomes found in the Malagasy was much more similar to the set of lineages
found in Borneo than in any other population, which demonstrates striking
agreement between the genetic and linguistic evidence. Similarly, a 'Centre of
Gravity' was estimated for every mitochondrial DNA to suggest a likely
geographical origin for each. This entails calculating a geographical average of
the locations of the best matches within a large database of mitochondrial
lineages from around the world.
"The Centres of Gravity
fell in the islands of southeast Asia or in sub-Saharan Africa,"
explained Dr Peter Forster, from the McDonald Institute for Archaeological
Research, University of Cambridge, one of the co-authors. "The
evidence from these two independent bits of DNA supports the linguistic evidence
in suggesting that a migrating population made their way 4500 miles across the
Indian Ocean from Borneo."
The striking mix suggests that there was substantial migration of people from
southeast Asia about 2000-1500 years ago - a mirror image of the migrations from
that region into the Pacific, to Micronesia and Polynesia, that had occurred
about 1000 years earlier. However, unlike the privations suffered by those
eastward travellers, the data suggests the early Malagasy population survived
the voyage well, because more genetic variation is found in them than is found
in the islands of Polynesia. 'Bottlenecks' in evolutionary history, where the
population is dramatically reduced in number, are a common cause of reduced
genetic variation.
Even though the Africa coast is only one-twentieth of the distance to Indonesia,
it appears that migrations from Africa may have been more limited, as less of
the diversity seen in the source population has survived in Madagascar.
But why, if the population is a 50:50 mix, is the language almost exclusively
derived from Indonesia?
"It is a very interesting
question, for which we have as yet no certain answer, as to how the African
contribution to Malagasy culture, evident in biology and in aspects of economic
and material culture, was so largely erased in the realm of language,"
commented Professor Robert Dewar, of The McDonald Institute for Archaeological
Research, University of Cambridge. "This
research highlights the differing, and complementary, contributions of biology
and linguistics to the understanding of prehistory."
The population structure in Madagascar is a fascinating snapshot of human
history and a testament to the remarkable abilities of early populations to
undertake migrations across vast reaches of ocean. It may also be important
today for cutting edge medical science.
"There has recently been
dramatic progress in the development of experimental and statistical methods
appropriate for gene mapping in admixed populations,"
said David Goldstein, Wolfson Professor of Genetics, University College London. "To
succeed, however, these methods depend on populations with well defined
historical admixtures. This work shows provides compelling evidence that the
Malagasy are such a population, and again shows the value of careful study of
human population structure."
Our human history is a rich mix of peoples and their movement, of success and
failure. Madagascar holds an enriching tale of the ability of humans to survive
and to reach new lands.
Notes to Editors:
Participating Centres -
Wellcome Trust Sanger Institute - Wellcome Trust Genome Campus, Hinxton, UK;
McDonald Institute for Archaeological Research - University of Cambridge,
Cambridge, UK; Weatherall Institute for Molecular Medicine - University of
Oxford, Oxford, UK; Department of Genetics - University of Leicester, Leicester,
UK
Publication details:
The dual origin of the malagasy in island southeast Asia and East Africa:
evidence from maternal and paternal lineages.
Hurles ME, Sykes BC, Jobling MA, Forster P
Am J Hum Genet. 2005;76;894-901. PMID: 15793703
Source: Wellcome
Trust Sanger Institute
Got the present author thinking: If it is said that,...
there was substantial migration of people from southeast Asia about 2000-1500
years ago - amirror image of the migrations from that region into the
Pacific, to Micronesia and Polynesia, that had occurred about 1000 years
earlier. However, unlike the privations suffered by thoseeastward
travellers, the data suggests the early Malagasy population survived the
voyage well, because more genetic variation is found in them than is found in
the islands of Polynesia. 'Bottlenecks' in evolutionary history, where the
population is dramatically reduced in number, are a common cause of reduced
genetic variation.
Even though the Africa coast is only one-twentieth of the distance to Indonesia,
it appears thatmigrations from Africa may have been more limited,
as less of the diversity seen in the source population has survived in
Madagascar.
...then in which populations, would such recent migrations from the African
coast possibly be reflected? Well, the following should instruct on the answer
to this question...
Recap: "**Malagasy
peoples are a roughly 50:50 mix of two ancestral groups: Indonesians and East
Africans.** It is important
to realise that these lineages have intermingled over intervening centuries
since settlement, so modern Malagasy have ancestry in both Indonesia and
Africa."
Details of genetics:
The Dual Origin of the Malagasy in
Island Southeast Asia and East Africa: Evidence from Maternal and Paternal
Lineages
Matthew E. Hurles,1,2 Bryan C. Sykes,3 Mark A. Jobling,4 and Peter Forster2
Linguistic and archaeological
evidence about the origins of the Malagasy, the indigenous peoples of
Madagascar, points to mixed African and Indonesian ancestry. By contrast,
genetic evidence about the origins of the Malagasy has hitherto remained partial
and imprecise. We defined 26 Y-chromosomal lineages by typing 44 Y-chromosomal
polymorphisms in 362 males from four different ethnic groups from Madagascar and
10 potential ancestral populations in Island Southeast Asia and the Pacific. We
also compared mitochondrial sequence diversity in the Malagasy with a manually
curated database of 19,371 hypervariable segment I sequences, incorporating both
published and unpublished data. We could attribute every maternal and paternal
lineage found in the Malagasy to a likely geographic origin. Here, we
demonstrate approximately equal African and Indonesian contributions to both
paternal and maternal Malagasy lineages. The most likely origin of the
Asia-derived paternal lineages found in the Malagasy is Borneo. This agrees
strikingly with the linguistic evidence that the languages spoken around the
Barito River in southern Borneo are the closest extant relatives of Malagasy
languages. As a result of their equally balanced admixed ancestry, the Malagasy
may represent an ideal population in which to identify loci underlying complex
traits of both anthropological and medical interest.
The island of Madagascar lies in the Indian Ocean, 250 miles from the African
coast and 4,000 miles from Indonesia. Paleoecological and archaeological
evidence suggest that, by
1,500-2,000 years ago,
Madagascar had become the last great island landmass to be settled (Dewar and
Wright 1993; Burney et al. 2004). The Malagasy language shares 90%
of its basic vocabulary with Maanyan,
a language spoken in the Barito River region of southern Borneo, which indicates
that the predominant ancestry of the Malagasy language most likely derives from
Borneo (Dahl 1951; Adelaar 1995). Malagasy also contains linguistic
borrowings from the Bantu
languages spoken in East Africa
(Dahl 1988). Furthermore, substantial
components of Malagasy material culture
(e.g., cattle pastoralism) could be derived
only from African sources.
At the time of the first Madagascan settlement, the entire Indian Ocean was a
vast trading network connecting China with the Mediterranean and all societies
in between (Vérin and Wright 1999). There is substantial
evidence of Islamic influence
and limited evidence of Indian
influence on the Malagasy, in
both language and culture.
In contrast to these cultural and linguistic traces of Malagasy ancestry, the
genetic origins of the Malagasy are relatively poorly understood, and
conflicting signals of African, Asian, and Pacific origin have appeared from
studies of different loci (Migot et al. 1995; Soodyall et al. 1995; Hewitt et
al. 1996). These contradictions result, in part, from being able to identify the
likely origins of only a subset of lineages present at any single locus.
In the present study, we employed the detailed phylogenetic and geographic
resolution of paternally inherited Y-chromosomal lineages and maternally
inherited mtDNA lineages to apportion Malagasy lineages to ancestral
populations. In this way, the contributions of the different ancestral
populations to the modern Malagasy gene pool can be estimated directly, and
likely geographic origins can be pinpointed with precision.
We assayed mtDNA and Y-chromosomal diversity in a Malagasy population sample
comprising four different ethnic populations: Bezanozano (n = 6), Betsileo (n =
18), Merina (n = 10), and Sihanaka (n = 3). Ten potential ancestral populations
(n = 327) representing major population groups within Island Southeast Asia and
Oceania were also analyzed with Y-chromosomal markers. To type all these samples
for the required number of Y-chromosomal and mitochondrial (mt) markers, it was
necessary to perform whole-genome amplification. Degenerate oligonucleotide-primed
PCR (Nrich [Genetix]) (Telenius et al. 1992) performed better than multiple
displacement amplification (Molecular Staging) (Dean et al. 2002) in early
trials and, consequently, was used throughout.
We selected 44 binary markers in the present Y-haplogroup phylogeny (Y
Chromosome Consortium [YCC] 2002; Jobling and Tyler-Smith 2003) that were
predicted to be particularly informative in this study. These markers were typed
using a combination of single-plex PCRs described elsewhere (Hurles et al. 2002;
YCC 2002) and nine novel PCR multiplexes, each analyzing between three and seven
SNPs. These multiplexes were designed to facilitate hierarchical typing, which
minimizes the amount of genomic DNA required to define lineages at high
resolution. These multiplexes use locus-specific primers tagged with universal
primers to enable a two-step amplification protocol that equalizes the
simultaneous amplification of multiple loci (Belgrader et al. 1996; Paracchini
et al. 2002). SNPs lying within these PCR products were subsequently genotyped
by single-base extension (SNaPshot [Applied Biosystems]) and capillary
electrophoresis. Primer extension reactions were performed in half the
recommended reaction volume but were otherwise processed in accordance with the
manufacturer's instructions. The amplification and extension primers used in the
present study are detailed in table 1.
Together, these markers define 41 Y-chromosomal lineages, of which 10 are found
in the Malagasy, 16 are found within Island Southeast Asia and Oceania, and 8
are found in East African populations (Luis et al. 2004). The Y-chromosomal
lineages in East Africa are
nonoverlapping with those found in Island Southeast Asia and Oceania
(see fig. 1). As a consequence of this population differentiation, it is simple
to apportion lineages found in the Malagasy to either an African or an Asian
origin. All but two Malagasy
lineages can be found in either East African or Southeast Asian populations. The
two unaccounted-for lineages are single chromosomes belonging to haplogroups L*
and R1b. Haplogroup L* is found at appreciable frequencies only in populations
bordering the northern Indian Ocean, and haplogroup R1b reaches highest
frequencies in northwestern Europe (Jobling and Tyler-Smith 2003). We believe
these two lineages most likely reflect recent admixture events as a result of
Indian Ocean trading links (Duplantier et al. 2002) and European colonization,
respectively.
To identify which Island Southeast Asian or Oceanic population represents the
most likely source population for the Asian lineages found in the Malagasy, we
computed pairwise FST distances, using the Arlequin software, to determine the
closest populations, in terms of genetic distance to the Malagasy. This analysis
indicates that, among the populations we sampled, the two populations from
Borneo are the best candidates for the likely source of these lineages (table
2). This genetic proximity between the Malagasy and Borneo populations reflects
the presence of appreciable frequencies of lineages O1b and O2a* in both
populations, as well as a relative lack of chromosomes belonging to O3 lineages.
The closest
single Island Southeast Asian or Oceanic population to the Malagasy is that from
Banjarmasin.
To explore the statistical significance of these observations, we devised a
permutation test to assess whether the genetic distance between the Malagasy (A)
and one population (B) is significantly smaller than that between the Malagasy
and another population (C). In this test, the individual haplotypes observed in
populations B and C are pooled and are randomly reassigned 10,000 times into two
simulated populations (B' and C') with the same sample sizes as B and C. The P
value of the difference in genetic distanceFST(A : B) - FST(A : C)is then
calculated as the fraction of simulated population pairs in which the difference
in genetic distance between each of the populations and the Malagasy is greater
than that observed in the real data(FST[A : B'] - FST[A : C']) > (FST[A : B]
- FST[A : C]). By use of this test, it was observed that there is no significant
difference between the two Borneo populations (P = .8374) but that the resultant
pooled Borneo population is significantly closer to the Malagasy than any other
Island Southeast Asian population (P < .001). The phylogeny of mtDNA
variation present in modern humans can be crudely
characterized as comprising L
lineages, present almost exclusively in Africa, and M and N lineages, present
almost exclusively outside of Africa. Thus, classifying mt genomes into these
major clades has significant power for discriminating between African and Asian
origins. We devised a novel multiplex using the single baseextension method
described above to type seven coding-region base substitutions (transitions at
positions 15043, 10400, 10398, 15301, 6455, 9824, and 10310) that define the M
and N lineages, as well as the R9 sublineage within haplogroup N and the M7
sublineage within haplogroup M (Kivisild et al. 2002), both of which are known
to be present in Island Southeast Asian populations (primers used in this
multiplex assay are detailed in table 1). Among 37 Malagasy mt genomes, we found
23 that belong to M and N lineages and 14 that belong to L lineages (fig. 2 and
table 3).
To further localize the geographical origins of Asian mtDNA lineages found in
the Malagasy, we studied the hypervariable segment I (HVSI) sequence of the mt
genome, for which a large volume of comparative data is available, we amplified
and sequenced HVSI, using primers TTAACTCCACCATTAGCACC and GAGGATGGTGGTCAAGGGAC
(Forster et al. 2002a) (between positions 16093 and 16362) in mtDNA from these
37 Malagasy individuals, and, by combining these data with the coding SNP
haplotypes described above, we defined 14 distinct maternal lineages in the
Malagasy (fig. 2).
A recently developed method for identifying the likely ancestry of a set of mt
sequences is to perform a "center of gravity" (CoG) analysis of
individual sequence types observed within a population (Röhl et al. 2001;
Forster et al. 2002b). In our CoG analysis, the best matches to an HVSI sequence
type were identified within a manually curated database of HVSI sequences
associated with a precise geographical location. A CoG was then calculated by
weighted interpolation of all best-match locations (see fig. 2). The relative
lack of published Island Southeast Asian HVSI data could hamper a CoG analysis.
To counteract this sampling bias, we added 82 HVSI sequences from Banjarmasin (n
= 21), Kota Kinabalu (n = 36), and the Philippines (n = 25) to the analysis.
These sequence types are given in table 3. Exact
matches within our database
of 19,371 HVSI sequences can be found
for all six maternal lineages
in the Malagasy that appear to
be Africa derived. By
contrast, exact matches
can be found for only three of
eight Asia-derived maternal lineages.
The CoGs observed in the Malagasy fall
within either Island Southeast Asia or sub-Saharan Africa.
These CoGs accord exactly with the lineage classifications: all sequence types
that belong to L haplogroups are found in Africa, and all sequence types that
belong to M and N haplogroups are found in Island Southeast Asia. The relatively
broad distribution of the Asian CoGs suggests that the present level of
geographical resolution afforded by a CoG analysis is not sufficient to enable
us to identify a single likely source population in Island Southeast Asia. It
does, however, allow us to exclude the possibility that a Pacific Island
population was the sole source of these mt lineages.
We calculated Nei's gene diversity (using the Arlequin software) in HVSI
sequences from the Malagasy and compared
it with diversity
apparent in the three Island
Southeast Asian populations
described above, as well as in published
data on Mozambique (Pereira
et al. 2001) and Oceanic
populations (Hurles et al.
2003b). The Malagasy appear to have diversity
that is significantly lower than that seen in Island Southeast Asia and
Mozambique populations(Pereira
et al. 2001) but that is higher
than that seen in Pacific
islands colonized within the
past 3,500 years (table 4).
The amount of genetic diversity observed in a population is heavily influenced
by demography and thus gives insights into settlement patterns. We might expect
that the presence of HVSI sequences from two diverse ancestral populations would
inflate HVSI sequence diversity; however, the lower genetic diversity in the
Malagasy compared with both ancestral populations suggests
either that early migrations were relatively restricted in numbers, duration,
and origin or that subsequent population bottlenecks resulted in a
postsettlement reduction of diversity.
Recently colonized islands often exhibit reduced genetic diversity as a result
of a combination offounder
events and elevated genetic drift due to lower population sizes.
However, this impact does not appear
to be as severe in the Malagasy as it is for Pacific Island populations with a
similarly recent settlement
(reviewed by Hurles et al. [2003a]). This observation holds true even when only
Asia-derived lineages are considered. This suggests that the sequential founder
events and bottlenecks that were a feature of Pacific Island settlement were
not paralleled in the colonization of Madagascar
from the East and provides support for a direct rather than multistep process of
migration from Indonesia. Alternatively, successive waves of migration from Asia
may have brought different sets of lineages to Madagascar.
If we calculate gene diversity separately for Asia-derived and Africa-derived
maternal lineages in the Malagasy, we find that the
Asian lineages are significantly more diverse.
These observations are largely explained by the predominance
of a single African HVSI sequence type(found
in 9 of 14 Africa-derived mt lineages). This sequence type is found
in all four Malagasy ethnic populations
sampled in the present study, so its predominance does not
result from genetic drift in a single Malagasy subpopulation.
Intuitively, one might expect fewer founders and therefore lower genetic
diversity from the more geographically distant ancestral population. However,
this does not appear to be the
case in this situation. Given
that the diversity apparent
within the two ancestral populations is comparable,
this implies that migrations
from Africa may have been more limited than those from Indonesia.
In principle, it would be interesting to test whether these differences in
Africa-derived and Asia-derived lineage diversity are replicated in the paternal
lineages of the Malagasy. However, it is well documented that estimates of
diversity that are based on genotyping known SNPs are biased
by the markers selected for genotyping and the geographic distribution of the
initial screening set used to
identify these markers (Jobling and Tyler-Smith 2003). As a consequence, it is
not appropriate to compare apparent SNP diversity between African and Asian
Y-chromosomal lineages.
The above analyses demonstrate that we can consider the Malagasy to be an
admixed population derived from two ancestral populations, one African and the
other Indonesian; we can now estimate the admixture proportions of these
populations. The mutual exclusivity of Y-chromosomal and mtDNA lineages between
these two ancestral populations means that we can obtain a point estimate of
admixture proportions simply by counting lineages. Of
Malagasy mtDNA lineages, 38% (14/37) can be traced to Africa, whereas 51%
(18/35) of Y-chromosomal lineages have an African origin.
This increases to 55%
(18/33) when the two putative
recently admixed Y chromosomes are removed.
When estimating admixture proportions, we are estimating the cumulative
contributions made by different ancestral populations to a hybrid population (Chakraborty
1986). We do not know the true frequencies of the different lineages in these
three populations at the time that admixture occurred, and we can only infer
these frequencies from sampling the contemporary populations that best
approximate these ancient populations. Various factors influence the accuracy
and precision of estimates of admixture proportions from contemporary
populations, including sampling errors, genetic drift in all populations, the
degree of population differentiation between the ancestral populations, and
mutations. Various statistical methods that take into account some of these
factors are available for estimating admixture proportions (reviewed by Jobling
et al. [2004]). Using the software LEADMIX (Wang 2003), we employed three
different statistical methods to estimate the proportion of African ancestry in
Malagasy paternal lineages; in order of increasing complexity, these estimators
are RH62 (Roberts and Hiorns 1962), L91 (Long 1991), and W03 (Wang 2003), the
last of which is a recently derived likelihood estimator that estimates rates of
genetic drift simultaneously in the ancestral and hybrid populations. These
three methods all gave very similar estimates of African admixture proportions,
which do not differ greatly from the estimate obtained from lineage counting:
58% for RH62, 56% for L91, and 56% for W03. There are broad confidence limits
(19%82%) for the latter likelihood estimate of paternal African admixture, which
encompasses the point estimate of the proportion (38%) of African ancestry from
maternal lineages. Consequently, the paternal and maternal estimates of the
proportion of African ancestry in the Malagasy are statistically
indistinguishable; there is no
evidence of ancient sex-biased admixture.
Further microgeographic sampling within Madagascar will be required to explore
how admixture proportions vary among different Malagasy ethnic populations.
Characterization of genetic ancestry in the Malagasy has hitherto remained
partial and imprecise. By contrast, in this study, because we generated
comparative data from a wide range of potential ancestral populations, we have
been able to identify the likely origins of all paternal and maternal lineages
found in four different Malagasy ethnic populations.
We have confirmed the presence of the mt "Polynesian
motif" among maternal Malagasy lineages,
as was reported elsewhere (Soodyall et al. 1995). However, direct
migration from Polynesia can be discounted,
since the predominant
Y-chromosomal haplogroups found in Polynesians, O3 and C, are not found at all
among Malagasy paternal lineages.
Among the 10 potential ancestral populations in Island Southeast Asia and
Oceania that we sampled, the Borneo populations had Y-chromosomal haplogroup
distributions that were the most similar to those observed among the Malagasy.
This observation is in striking agreement with the linguistic evidence that the
Malagasy language is most closely related to the Maanyan language from the
Barito River Valley in southern Borneo. Now that we have identified the region
of origin for this Asian migration to Madagascar, further microgeographic
sampling within Indonesian islands may pinpoint more precisely the origins of
the Malagasy. Populations that possess both the paternal (e.g., O1b and O2a*)
and maternal lineages (e.g., Polynesian motif) that are common in the Malagasy
would be of particular interest. It is intriguing that the majority
of Asia-derived mtDNA types present in the Malagasy do not have exact matches in
an extensive database of HVSI sequences,
and identification of these specific mtDNA sequence motifs within potential
ancestral populations in Indonesia should be a priority. However, it must be
remembered that genetic diversity in contemporary populations is an imperfect
proxy for variation within ancient populations. The ongoing processes of
population fission and fusion as well as genetic drift may prohibit the
identification of a precise contemporary population that exactly represents the
ancient population from which migrants departed. In addition, the possibility
remains that migration either occurred
from several genetically distinct sources within Indonesia or was kin structured
(Fix 1999), such that no ancient population ever had the same lineage
distribution as that of the migrants to Madagascar.
Admixture between two highly differentiated populations generates long-range
allelic associations that decay over time (Chakraborty and Weiss 1988). The
amount of linkage disequilibrium (LD) exhibited by an admixed population depends
on a number of factors, including proportions of admixture, differentiation
between ancestral populations, time since admixture, and demography (Pfaff et
al. 2001). It has been proposed that it will be possible to efficiently map
genes underlying complex traits by focusing on association studies in admixed
populations, and a range of potentially informative populations has been
identified (Halder and Shriver 2003). Although the time since admixture in the
Malagasy is comparatively long, the high degree of differentiation between the
two ancestral populations and the even balance of their contributions suggest
that excess LD might still
exist. Admixture mapping of
genes underlying complex traits is predicated on the observation that the trait
itself is differentially manifested among the ancestral populations. Therefore,
although most attention has focused on European and African admixture in African
Americans (Halder and Shriver 2003), it would be of interest to identify a range
of admixed populations that are derived from various different ancestral
combinations. The admixture of Indonesian and African lineages present in the
Malagasy may be uniquely informative. Further characterization of LD in the
Malagasy will be necessary for determining whether the Malagasy can be added to
the list of admixed populations suitable for the identification of genes
underlying complex traits that are of interest to anthropologists and medical
geneticists alike.
Recap from above:
It is intriguing that the majority of Asia-derived mtDNA types present in
the Malagasy do not have exact matches in an extensive database of HVSI
sequences, and identification of these specific mtDNA sequence motifs within
potential ancestral populations in Indonesia should be a priority.
In the Malagasy haplogroup mapping provided by the authors of the study, the
typical African markers of interest are: B*(xB2b), B2b, E2b & E3a. Total
African out of 33 between the African MRCA lineages and the Asian counterparts,
is 18/33, leaving the Asian MRCA lineages to 15/33.
E3a seems to be relatively significant in the African contribution!
Other lineages — which are generally labeled as "Asian"
within circles of geneticists — to be noted are: J, L*, O1b & O2a*.
*Unedited* extracts from Metmuseum.org:
Timelines of East and South Africa from 1st century
to the 17th:
• 1st–7th century The kingdom of Aksum originates as an urban
center founded by Ge'ez-speaking people and situated in the highlands of
Ethiopia, later growing to encompass much of modern-day Ethiopia and Eritrea and
even conquering distant southern Yemen for a time. With access to the lucrative
Red Sea trade through Adulis, its port city, Aksum becomes an important link in
the network extending from the Roman empire to India. In 270 A.D., Aksum begins
minting its own gold coins to facilitate international trade, following the
model of Roman coinage. These coins provide visual evidence of a far-reaching
religious and cultural shift that occurs in 330, when the Aksumite ruler Ezana
(r. 320–50 A.D.) converts to Christianity; previously bearing a southern
Arabian disk and crescent, coins are thereafter imprinted with the Christian
cross. Ezana's conversion may have reflected his desire to cement relations with
the Greek-speaking world of the Mediterranean; the influence of Greek culture is
shown in the inclusion of Greek inscriptions alongside those in Ge'ez on
Aksumite monuments of the period. Aksum declines in the seventh century, when
Islamic Persians take control of the trade routes upon which it depends, but its
Christian legacy remains vital in Ethiopia to the present day. Aksum is now
principally known for the monolithic stelae erected at its capital city during
the third and fourth centuries.
• ca. 500 The Lydenburg heads, a group of seven ancient fired
earthenware heads found in the Transvaal of South Africa and named after the
site where they were discovered, are buried in a manner suggesting careful
deliberation. While their meaning is unclear—they may have been used in
masquerades as part of initiation rites—the heads remain the most impressive
works of Early Iron Age art yet discovered in the southern regions of the
African continent.
• 8th–9th century Trade brings Arab merchants to the East African
coast. Gradually this trade leads to the formation of settlements (which are
nevertheless primarily African communities) and intermarriage with local African
populations, giving rise to the Swahili Coast Culture. Exports include ivory,
slaves, ambergris, and gold. Zanzibar eventually develops as a slave warehouse.
• 8th–9th century The site of Kilwa on the coast of modern-day
Tanzania is first occupied. Originally a fishing and weaving community that may
have traded with interior settlements, Kilwa later develops into one of the most
important trading centers on the Swahili coast. Ivory is probably a major item
of trade, exchanged for ceramics brought from the Persian Gulf by Arab
merchants. Locally minted silver and copper coins, dated between 980 and 1100,
are found on Pemba Island.
• ca. mid-9th century Late Iron Age sites such as K2 (Bambandyanalo)
emerge in the Limpopo River valley, as well as the earliest walled settlements
to appear on the Zimbabwean plateau. Goods such as imported glass beads found at
both centers indicate the existence of trade with the eastern coast of Africa.
Abundant tools and ivory ornaments found at K2 point to a thriving ivory-working
industry. The K2 community declines in the mid-eleventh century with
Mapungubwe's rise to power.
• ca. 1050–1270 The settlement of Mapungubwe, located in the
Limpopo River valley of present-day Zimbabwe, is supported by an economy based
on livestock and trade. By controlling the flow of cattle and goods such as
ivory, rhinoceros horn, and gold, the elite of Mapungubwe create status
divisions that are reinforced with visual metaphors. Living atop the hill on
which the site was founded, they remove themselves from the rest of the
community behind monumental walls. Ivory hunting, copper mining, and trade in
gold are important activities of the Mapungubwe rulers. Craftsmen develop the
art of metalwork, particularly gold, creating gold bangles, beads, and, most
notably, gold-plated rhinoceros sculptures. Engaged in commerce with the Swahili
coast, traders from Mapungubwe exchange their goods for glass beads, cloth, and
Chinese celadon. The city is abandoned shortly after Great Zimbabwe's rise to
prominence in the thirteenth century.
• ca. 12th–13th century At the site in Ethiopia now called
Lalibela (after the ruler Lalibela, r. late twelfth–early thirteenth century),
a group of churches are carved directly from the rock of the Lasta Mountains
under the auspices of the Zagwe dynasty. Like the monuments and tombs of Aksum,
these buildings are carved to look as though they were conventionally built from
assembled materials, but in fact are hewn from unified masses of stone. This
complex of eleven churches, originally called Roha (Arabic for Edessa, a
reference to the city blessed by Christ), evokes multiple sites intended to
associate the Zagwes with strong religious and political predecessors. In
addition to being a new incarnation of Edessa, with all the divine favor implied
by that status, Lalibela is intended to represent a new Jerusalem. Areas within
the Lalibela complex replicate the names of holy sites such as the church of
Golgotha, strengthening these associations with visual cues. The Church of the
Redeemer, for example, makes explicit political reference to Aksum, quoting the
architectural structure of Aksum's famous cathedral, Saint Mary of Zion. After
becoming associated with the Ethiopian saint Lalibela in the early fifteenth
century, Lalibela's meaning shifts and the complex develops into a thriving
pilgrimage center.
• ca. 1250–1450 Great Zimbabwe is founded by Bantu-speaking
ancestors of the Shona people. Like its predecessor Mapungubwe, Great Zimbabwe's
economy is based on cattle and supplemented by trade. The city utilizes the
stone wall of the plateau region on a scale never equaled thereafter. The
sinuous, massive walls of its complexes reach a height of thirty-six feet in
some areas, constructed entirely without mortar from slabs of stone. These walls
adjoin clay and wattle huts to form elaborate courtyards intended to house the
ruling elite. Beyond architecture, Great Zimbabwe produces little in the way of
visual art, with one significant exception: the soapstone birds combining human
and animal features, which are later adopted as national symbols (one currently
adorns the flag of Zimbabwe).
• ca. 13th century The Swahili culture, reflecting the settlement of
Muslim Arab merchants along the eastern coast and their intermixture with local
East African peoples, becomes well established in powerful trading centers. The
rise of the Swahili town of Kilwa coincides with the ascendance of Great
Zimbabwe, which supplies Kilwa with ivory, gold, and food.
• ca. 13th century The first stages of the Great Mosque of Kilwa and
the secular palace complex of Husuni Kubwa are erected in what is now Tanzania.
These buildings, constructed of local coral blocks, represent the first and
finest flowering of Swahili architecture. Although stylistic influences can be
traced to sources as disparate as Arabia and India, the synthesis achieved here
is distinct to the Swahili coast.
•300 B.C.–16th century A.D. The Bantu migration from the
Cameroon-Gabon area to the coasts of East and South Africa concludes. Among
other things, Bantu-speaking peoples introduce iron technology to the region.
• 1270–1530 The Early Solomonic period in Ethiopia is one of
increased prosperity due to both political stability and Ethiopia's central
location along several pivotal trade routes crossing sub-Saharan Africa and
extending into Asia. The centralized monarchical leadership commissions the
construction of lavishly decorated and painted rock-hewn royal churches,
importing artisans and materials from around the world. Monasteries, attended by
Ethiopia's nobility, are established as centers of artistic and scholarly
learning and production.
• 13th–16th century The rise of the prosperous coastal towns of
Mombasa, Malindi, and Kilwa (in present-day Mozambique, Tanzania, and Kenya) is
the result of Islamic immigration from the northwest and the establishment of
trading networks across the Indian Ocean. Gold, slaves, and ivory are traded for
cloth, beads, metal goods, silks, and porcelain. Arabic colonies, of the type
established at Gedi (near Malindi) on the Kenya coast from the fourteenth to
sixteenth century, often include a palace, several mosques, and tall stone
houses for nobility. Construction is usually completed in coral slag, with stone
reserved for the ornate detailing around doors and windows.
• 1434–1468 Emperor Zar'a Ya'eqob of Ethiopia mandates the reading
of the Miracles of the Virgin Mary, thus establishing Mary as a primary visual
and liturgical icon in the Ethiopian practice of Christianity. The court painter
Fre Seyon (1434–1468) gives visual expression to Emperor Zar'a Ya'eqob's
sacred poetry about the Virgin, reflecting the emperor's interpretation of her
as a sensitive and forgiving mother.
• 1488 The first Portuguese explorers land in South Africa, stopping
to restock water and food and to repair their ships, setting a precedent that
will continue for the next 150 years. In the sixteenth and seventeenth
centuries, as more traders take the southern route from Europe to India, the
colony of Cape Town is established as an important stopover along what is often
more than a year-long voyage.
• 1498 The Portuguese reach the Swahili coast, finding an
established, sophisticated network of intercontinental commerce as well as
several sizable prosperous cities.
• 1505–1650 With the support of Portuguese royalty and under the
auspices of a Christian brigade against Islam, the Portuguese establish military
forts from which they attack and destroy several large cities—including Kilwa
(Tanzania) and Mombasa (Kenya)—and attempt to dominate the Indian Ocean trade.
Revolts among the local populations in Mozambique and Kenya meet with differing
levels of success. Additionally, important military alliances against the
Portuguese are established between Islamic traders. Besides the introduction of
several food products, including cassava, maize, and the tomato, the Portuguese
have a minimal impact on the cultures of East and South Africa.
• 1527–1543 Islamic jihads against Christian Ethiopians by the
neighboring kingdom of Adal destroy many of Ethiopia's churches, libraries, and
monasteries, causing the loss of centuries of invaluable records.
• 1593 The Portuguese build Fort Jesus at the entrance to Mombasa
harbor, allowing them to sack and plunder the city, destroying much of the
Islamic architecture.
• 16th century–ca. 1650 The Torwa state (also called Butwa), which
appears to be an outgrowth of the Great Zimbabwe culture, continues the region's
tradition of monumental stone architecture. Mortarless walls composed of shaped
and fitted stones are found at sites in Matendere, Khami, and Danangombe.
•16th–17th century The Mutapa state, located south of the Zambezi
River in present-day Mozambique and Zimbabwe, emerges as an important regional
power controlling trade routes from the interior of southern central Africa to
the coast. Gold, silver, and ivory, as well as locally produced cloth, are
exchanged at the coast for silks, ceramics, and other goods of foreign origin.
...
Shifting back to western Africa momentarily...
BEFORE OUR ANCESTORS
The heads have yet to be accurately dated but similar stones in Senegal date
back as far as 2,000 years.
(click to enlarge)
``No one knows what role the heads played in ancient times,'' Niangoran-Bouah
said.
``They are not the work of men known to us or our ancestors,'' said Ta-bi-Tra, a
hunter at Gohitafla, now inhabited by Ivorian President Henri Konan Bedie's
ruling Baoule tribe. Baoule warriors arrived there under Queen Abla Pokou in the
17th century, displacing Gouro tribes who in turn had pushed out the Wan culture
in the 15th century.
``The Wan consider them to be ancestral objects,'' said Niangoran-Bouah, citing
the stories of nearby Wan descendants, including a theory that the heads
betrayed them to the enemy.
The heads are also seen as grave charms for Wan warriors, homes for dead mens'
souls or guardian spirits and talismans.
``We make offerings for a safe voyage, to find a good partner or fight off evil
sorcerers, eaters of souls, jealous people and poisoners,'' said one soothsayer.
``We trust them.''
Animal sacrifices in cult rituals ensured successful childbirth and stone heads
still play a part in ritual exorcisms and purification of adulterers. One man
described being inhabited by a spirit from stones surrounding his house. ``I
have 13 children, they all come from the stones.''
Prehistoric stone heads have been found around the world, from Africa to Europe
and America. Marahoue's are thought to be among the largest and oldest along
Africa's Atlantic coast.
Ivorian standing stones are larger than average and found deeper in the ground
than similar African examples, suggesting a greater age of up to 7,000 years,
Niangoran-Bouah said.
Such African megaliths weighing between half a ton and 15 tons are found in a
northwestern strip on the Mediterranean and pockets in a wide west-east
sub-Saharan band between Senegal and Kenya. Villagers showed Reuters a 19-foot
rock said to be one of the largest African megaliths.
In Mali, to the north, anthropologists have been baffled by the Dogon culture's
ability to predict cycles of an invisible satellite of the star Sirius, which
appears every 60 years. The Dogon, whose God Amma is said to have thrown a ball
of clay into space to create Earth, is just one example of deep civilization in
Africa often brushed over by colonists.
``This civilization before the pre-colonial period honorsour country,''
Niangoran-Bouah said. ``During colonial times the stones were probably kept
hidden in the forest. The whites did not see them.''
That, for better or worse, is no longer the case.
Source: www.iol.ie/~afifi/BICNews/History/history1.htm
"The problem is that West Africa's tropical climate means clues to
history often rot, leaving only rich oral tradition."
In the meantime, going southward, and unedited from metmuseum.org!...
c.1000 BC - 1st AD
Game Pass Shelter
Kwazulu-Natal
South Africa
Courtesy of the Rock Art Research Institute, University of the Witwatersrand,
South Africa
RSA GAM 106 2A
Game Pass Shelter
Kwazulu-Natal
South Africa
Courtesy of the Rock Art Research Institute, University of the Witwatersrand,
South Africa
RSA GAM 95
African Rock Art: Game Pass
High in a secluded valley in the Drakensberg
Mountains is the spectacular site of Game Pass. Here, on the walls of a narrow
sandstone shelter, are painted a great many images of eland (the largest of all
antelopes). For a shelter so open to the elements, the paintings are
miraculously well preserved and in some places the brush marks can still be
seen. Situated among the many images of eland are smaller human figures in
running postures. This site, however, is most famous for a cluster of images
tucked away on one side of the shelter. It was extensive analysis of these
images that first led scholars to the realization that the art was a system of
metaphors closely associated with San shamanistic religion.
This cluster of images is comprised of an eland with
closely associated anthropomorphic figures. The eland's head is lowered, turned
toward the viewer with staring hollow eyes. Its one front leg bends under its
weight, while its two back legs are crossed over as it stumbles, and the hair on
its neck and dewlap is erect. This sort of behavior is characteristic of eland
when they have been wounded by one of the poisoned arrows that the San use to
hunt. They stumble about, their heads sway loosely from side to side, they sweat
profusely and even bleed from the mouth and nose, and the hair along their neck
and back stands erect. This image, then, is of an eland in its final death
throes.
Behind the eland, a human figure holds the tail of
the animal; this figure's legs are also crossed, mimicking those of the eland's
back legs. This human figure's legs continue all the way underneath the rock
shelf, and close inspection reveals that the figure does not have feet but
antelope hooves. Next to this figure are two more in similar pigment. The first
is of a human figure bending forward with one arm stretched out behind its back.
It apparently has no head—although the pigment may have worn away—and a
short skin-cloak, known as a kaross, falls from the chest. Just above and to the
right of this figure is one with an animal head, wearing a full kaross. To the
right, in an orange pigment, is another human figure with an arm behind its
back. This figure too, like the one clutching the eland's tail, has antelope
hooves instead of feet and its hairs are erect like those on the eland itself.
The arms-back posture—adopted by contemporary San at dances in the Kalahari
Desert of Namibia and Botswana when they ask God to infuse them with
supernatural energy—is frequently depicted in San art. Bending forward is
closely related to the arms-back position and is adopted by dancers when the
supernatural energy begins to "boil" in their stomachs. These three
human-animal figures suggest a close association between the dying eland and the
ecstatic experience of dancers.
Indeed, in the Kalahari, the San often like to
perform a trance dance around or near the carcass of a freshly killed eland in
order to harness supernatural energy (known as n/om) from the animal. When they
have harnessed this energy, they enter an altered state of consciousness in
which they stumble about, sweat profusely, and the hair on their bodies stands
on end. So closely are the experiences of trance and the death of eland in their
physical manifestation that the San talk about trance as "the death that
kills us all." They speak of their experience metaphorically; for them,
there is no difference between death and trance.
The link between the dying eland and the human figure
clutching its tail in this cluster of images is a graphic metaphor—an allusion
to the close parallels between death and trance. Once
this metaphor was identified at this site, a new vista opened up for scholars,
and many other religious metaphors and symbols were identified in San art. It is
for this reason that the site is often referred to as the Rosetta Stone of
southern African rock art.
Nile
Valley Peoples1 | Nile
Valley Peoples 2 | Quotations
| Hair
| Blood
types | Notes1
| Articles
|
Home | Quotations
| Misc
Notes | Hair
| DemicDiff
|
Egypt in Africa