THE SUCCESS STORIES
A. Hepatitis B Surface Antigen Expressed In Transgenic Plants
A highly effective and safe hepatitis B vaccine was licensed in the U.S. in 1986. It has been a great commercial success, with sales in the industrialized world exceeding $ 1 billion/ year. With this outstanding product on the market, it is valid to ask why we have pursued an alternative vaccine to prevent hepatitis B virus (HBV) infections. As will be detailed below, the answer lies in finding an equivalent or equivalent or improved vaccine that will serve poorer countries of the world, where the HBV disease burden remains at epidemic levels, and vaccine costs preclude the use of the currently available product.
The existing vaccine to prevent HBV infection is a biotechnology product that falls in the category of “subunit vaccine.” The gene encoding the hepatitis B surface antigen (HBsAg) is expressed in yeast cells grown by fermentation; the cells are broken, the protein is collected, and the HBsAg is caused to refold by chemical treatment to yield virus - like particles that can be formulated for injection. The resulting vaccine is the epitome of modern macromolecular pharmaceuticals derived from recombinant DNA technology; it is a superior product that contains only a “subunit” of the disease - causing agent. However, it is technology-intensive and therefore comparatively expensive as a health - care product for developing countries.
Although the licensed HBV vaccine developed to date have been for parenteral delivery, there is no a priori reason to exclude oral delivery. Oral vaccines are highly desirable from several standpoints. They can serve multiple immunization priorities, including simplicity of use (i.e., delivery of multiple immunogens), increase in compliance (as a result of increased ease / comfort of delivery), enhanced immune responses at mucosal sites, and stimulation of humoral immunity. For pathogens that cause enteric, respiratory, or sexually transmitted diseases, mucosal immune responses will provide an essential first line of defense. A highly successful oral vaccine that is globally available today contains attenuated poliovirus. However, to the present time subunit vaccines have not been licensed for oral delivery, in part because of the lack of cost - effective production technology.
Researchers have previously shown the expression of HBsAg in tobacco plants and have demonstrated that the plant - derived antigen was immunogenic when administered parenterally to mice. They have now chosen to pursue a new strategy for HBsAg production in edible plants and to test a previously unused route of immunization (oral) for HBsAg delivery. The justification for the use plants is 2 - fold. First, transgenic edible crops can be produced at low cost. Furthermore, the technology development cost for creating the vaccine-producing plant can be fully borne at the outset of the project (such as by investments and/or philanthropy in the developed world), but then “in - country” production of the product by using indigenous agriculture and food processing technology would be used for product manufacture. In this way, sustainability of immunization, and independence from foreign supply, can become national priorities, and long - term public health can become both a source of national pride and local health - care company development.
Methods
Generation of HBsAg Transgenic Tubers. The HBsAg gene from a pMT-SA clone of a Chinese adr isolate of HBV was inserted into a transformation plasmid vector pHB114 that was mobilized into Agrobacterium tumefaciens (LBA4404), which was then used to transform Solanum tuberosum L. cv. FL1607. The transformed FL 1607 was cured of the A. tumefaciens and clonally propagated, and the Fl 1607 HB 114-16 line was selected for its high level of HBsAg expression. This line was then clonally propagated to multiply the number of plants and potted in soil to produce the potato tubers. Extracts of the FL 1607 HB 114-16 line expressed HBsAg detected by ELISA (AUSZYME, Abbott). The tissue from the untransformed FL 1607 tubers did not express any proteins that were reactive with antibodies to HbsAg.
Transmission Electron Microscopy (TEM). Transgenic potato plant of line HB114-16 and nontransgenic control FL 1607 plants were grown in tissue - culture boxes on standard plant inorganic nutrient agar. Young growing leaves were excised, cut into 1-mm squares with a razor blade, and fixed in 2% paraformaldehyde + 2% glutaraldehyde in 0.1 M sodium cacodylate buffer, pH 6.8, for 0.5 h at 23 ºC followed by 1 h at 4 ºC. The tissue was postfixed in 2% osmium tetroxide at 23 ºC for 1 h, washed , and dehydrated in a graduated ethanol series at 4 ºC, 1:1 ethenol/acetone, and 100% acetone. The tissue was infiltrated with epon/araldite resin at 23 ºC and cured at 60 ºC overnight. Section of about 70 nm in thickness were obtained with a Reichert Ultracut E microtome. The section were viewed on a Philips 201 TEM and Philips Tecnai 12 Biotwin (Philips, Eindhoven, The Netherlands).
Oral Immunization with Yeast - derived Recombinant (r) HBsAg. Before oral immunization, groups of mice were deprived of food for 2 h, followed by intragastric of 0.2 ml of an isotonic bicarbonate solution (8 parts Hanks' balanced salt solution and 2 parts of 7.5% sodium bicarbonate) to neutralize stomach acidity. Mice were then immunized with 150 µg of rHBsAg mixed with 10 µg of cholera toxin (CT) in a final volume of 0.2 ml. Oral dosing was done by using a 1 -ml syringe fitted with an oral feeding needle.
Feeding Mice Transgenic Potatoes. Tubers of transgenic potato line FL 1607 HB 114-16 expressing HBsAg at 8.35 µg/gm of fresh tuber weight were used to feed BALB/c mice that were fasted overnight before being fed peeled cubed raw tuber. Nontransformed line FL1607 was used as the control tuber. For the boiled potato experiment, potatoes were cooked in boiling water » 10 min until soft. For each experiment, 10 mice were fed either 5 gm each of FL1607 or FL1607 HB 114-16+10 µg of CT (Sigma) once per week for 3 consecutive weeks. Each mouse was housed separately for the feedings and the amount of tuber weighted before and after feeding to monitor the amount ingested by individual mice. The potato was left in the cage until all of it was consumed or 24 h afterwards, whichever was earlier.
For the duration of the experiment, animals were fed regular animal chow. At the times indicated in the legend to mice were injected with 0.5 µg of yeast-derived alum-adsorbed rHBsAg (Merck Sharpe and Dohme).
Measurement of Anti-HBsAg Antibodies. Antibodies to HBsAg were detected by using the AUSAB EIA (Abbott). Polystyrene beads coated with HBsAg were incubated with the serum from either experimental or control animals for 18 ± 2 h at room temperature. At the end of this incubation period, beads were washed and HBsAg tagged with biotin, and rabbit antibiotin conjugated with horseradish peroxidase was incubated at 40 ± 1 ºC for 2 h with the antigen-antibody complex bound to the beads. Unbound biotin-antibiotin complex was removed, and the beads were washed. Next, o-phenylenediamine solution containing hydrogen peroxide was added to the bead and the reaction allowed to proceed for 30 min at room temperature. The reaction was stopped by the addition of 0.5 M sulphuric acid. The yellow color that develops is proportional to the amount of anti-HBsAg bound to the beads. The absorbance is measured at 492 nm in a Quantum II (Durham, NC) spectrophotometer. The AUSAB quantitative standard panel is included with each assay performed and permits the conversion of OD values to milli-International units (mIU)/ml.
Results
They tested the immunogenicity of recombinant HBsAg derived from yeast (purified soluble product) administered to mice by oral gavage. Mice were immunized with 150 µg of rHBsAg mixed with 10 µg of CT by oral gavage once per week for 2 consecutive weeks. A group of control mice were gavaged with PBS plus 10 µg of CT. No serum HBsAg-specific antibodies were detectable in mice of either group at up to 6 weeks, at which time all animals were boosted with a subimmunogenic dose of alum-adsorbed yeast rHBsAg. Only mice that had been orally primed with rHBsAg made an immediate secondary antibody response, with a peak response of 175 mIU/ml at week 7. No HBsAg specific antibodies were detectable in the control mice.
To determine whether expression of HBsAg in a plant presented any special advantage (protection from rapid degradation in the gut, slow release of antigen), they created transgenic potato plants that express HBsAg in tubers. For this study, they used line FL1607 HB114-16, which was transformed with pHB114. The HBsAg gene is unmodified from its native form and therefore is expected to be targeted to the endoplasmic reticulum (ER), as observed in yeast recombinant expression. They examined cells of HB114-16 and nontransformed FL1607 plants by TEM to determine whether HBsAg accumulates as virus-like particles (VLP). HB114-16 cells harbored unusual membrane-bound vesicular bodies. These vesicles, which may be derived from ER, contained circular structures that are »17 nm in diameter. This image provides, to our knowledge, the first evidence in transgenic HBsAg-expressing plants that the antigen is retained within vesicular structures. They have shown in a detailed study that the material within the vesicles stained specifically with antibody against HBsAg (M. Smith, L.R., C.J.A., M. Shuler, and H.S.M., et al., unpublished work). These circular structures are very similar to the VLP found in serum samples of HBV-infected patients, and the distended ER vesicles are similar to the VLP found in serum samples of HBV-infected patients, and the distended ER vesicles are similar to those produced in yeast expressing rHBsAg or Chinese hamster ovary cells transfected with the HBsAg gene. Microscopic examination of cells of nontransformed FL1607 leaves did not reveal any subcellular vesicles containing circular structures. They thus conclude that transgenic plant cells accumulate rHBsAg inside membrane vesicles, and that the recombinant antigen assembles in structural units.
Structure of the T-DNA region of pHB 114, the vector used for expression of HBsAg. The small HBsAg gene is inserted an expression cassette from which transcription is driven by the cauliflower mosaic virus 35S promoter. The tobacco etch virus 5'-UTR provides enhancement of translation, and the Pin 2 3' element mediates polyadenylation. The selectable marker for plant transformation is the Npt2 gene, with confers resistance to kanamycin. LB and RB indicate the left and right borders of the T-DNA region, which, during Agrobacterium - mediated DNA delivery, become stably integrated into nuclear chromosomal DNA.
For animal feeding experiments, plants were grown to maturity in soil and harvested to collect tubers, which contained on average 8.35 µg of HBsAg per gram of fresh tuber. To evaluate the oral immunogenicity of HBsAg expressed in potato tubers, we fed peeled potato piece to mice once per week for 3 consecutive weeks. Each mouse received 5g of tuber(containing an average of 42 µg of HBsAg per dose) per feed. CT was used as a mucosal adjuvant, and 10 µg of CT was placed on the potato pieces and consumed by the animals in conjunction with the antigen. Nontransformed potatoes FL 1607 plus CT were fed to groups of control mice. Serum samples of all mice were analyzed for the presence of anti- HBsAg antibodies, and the results are expressed as mIU of HBsAg - specific antibody per milliliter of serum.
Multiple long-term immunogencity and efficacy trials of the current licensed hepatitis vaccine have defined a protective anti- HBsAg level as > 10 mIU/ml. In mice fed HBsAg -transgenic potatoes, anti- HBsAg antibodies were first detected 1 week after two doses; the response was increased to a peak value of 103 mIU/ml 4 weeks after the third dose and was > 10 mIU/ml at week 11. To determine whether memory immune cells had been established as a result of oral immunization, all animals received a parenteral boost of a subimmunogenic dose of 0.5 µg of alum-adsorbed yeast-derived rHBsAg vaccine after the primary response antibody levels had returned to baseline. An immediate and strong secondary antibody response was obtained only in mice that had been previously fed HBsAg - transgenic potatoes. A peak antibody response of 3,300 mIU/ml was measured 3 weeks after the booster injection, and the response was maintained at high levels (700 mIU/ml) 5 month later, when the experiment was terminated. Mice fed control nontransformed potatoes following a schedule identical to that for the experimental group showed no primary antibody response, and no response could be elicited in these mice after boosting with the same parenteral does of rHBsAg, which elicited a strong secondary response in the experimental mice. Collectively, the data allow us to conclude that plant-drived HBsAg, delivered as food, is orally immunogenic in mice and will elicit a primary antibody response. Furthermore, the strong secondary response seen after boosting with rHBsAg represents a true memory response, generated as a result of the mice being fed HBsAg transgenic potatoes; it was not merely a primary response caused by parenteral injection of rHBsAg.
In converse experiments, they tested the ability of the HBsAg transgenic tubers to boost mice that had been primed with a single injection of the yeast-derived recombinant HBsAg. They first immunized mice with a single subimmunogenic parenteral dose of rHBsAg, which resulted in no detectable increase in anti HBsAg antibodies over 5 weeks. When we then boosted them with three weekly feedings of HBsAg transgenic potatoes, a rapid increase in anti-HBsAg antibodies occurred after ingestion of the second dose of HBsAg -transgenic potatoes, and a peak antibody of > 1,000 mIU/ml was measured 3 weeks after the third feeding. When mice were fed control nontransformed potatoes after a single priming dose of yeast rHBsAg, no antibodies were generated at any time point, thus confirming the specificity of the response measured in the sera from experimental mice.
They further examined the ability of transgenic potato tuber to stimulate a primary anti-HBsAg immune response in the absence of an oral adjuvant. Feeding of three weekly doses of HB 114-16 tubers without CT resulted in a very limited and transient primary response, which was boosted to a maximum of 48 mIU/ml after challenge with an injection of rHBsAg. We conclude that CT exerted a substantial adjuvant effect, because feeding of HBsAg - tubers with CT stimulated a stronger antibody response.
To determine the effect of heat on the immunogenicity of HB 114-16 tubers, a sample transgenic potatoes was boiled before feeding. When mice were fed the boiled tubers plus the adjuvant CT, following a schedule identical to that used when mice were fed fresh uncooked HB 114-16 tubers, no primary antibody response was detected. Further, when these mice were boosted with the subimmunogenic dose of rHBsAg, anti- HBsAg antibody levels of 135 mIU/ml were elicited in contrast to the peak secondary antibody response od 3,300 mIU/ml in animals fed uncooked tubers.
They therefore conclude that heat adversely affected but did not eliminate the immunogenicity of the HBsAg - transgenic plant derived vaccine, at least at this duration and level of heating.
Discussion
Researchers have previously produced HBsAg in tobacco plants and administered it to mice as a parenteral vaccine. The plant-derived sample elicited B-and T-cell responses similar to those obtained against the commercial vaccine (3). Because toxic alkaloids in tobacco preclude its use in feeding experiments, they optimized the expression of HBsAg in potatoes. The present study was designed to test the potential of potato tuber expressing HBsAg to provoke immune responses when mice were fed this edible vaccine. The maximum dose of HBsAg in the present studies was imposed by the animals themselves, because it was found that they would reliably eat up to 5g of raw tuber overnight, once per week ( or about 42 µg HBsAg/dose).
Primary and Booster Immune Responses: Three feedings of transgenic potatoes with CT gave a primary serum antibody response that rose above 100 mIU/ml but declined to less 10 mIU/ml by week 12. The increase in serum antibody could be detected after two doses of potatoes, whereas two doses of purified yeast - derived HBsAg gave no detectable serum antibody increase, even though the dosage of yeast -derived material was 4 - fold higher.
Establishment of a memory response is critical in studies pertaining to vaccine design and implementation. Studies show that feeding fresh raw HBsAg potatoes to mice stimulated a primary immune response, and that several weeks after the decline of specific antibodies to background levels, a single parenteral injection of rHBsAg provoked a rapid and robust recall response that persisted for at least 5 months. No responses to the parenteral boost were obtained in mice that were fed nontransgenic potatoes, showing that the boosting response elicited in animals fed HBsAg tubers was indeed the result of priming and establishment of immune memory to HBsAg presented in the gut. These data indicate that HBsAg, produced and delivered in transgenic potato, is an effective oral immunogen. The peak levels of antibody 3,300 mIU/ml, obtained after parenteral boosting, were impressive in view of the rather modest level of » 42 µg of HBsAg delivered per dose of potato vaccine.
They have compared the oral immunogenicity of purified rHBsAg (from yeast) to that delivered in unprocessed potatoes. No primary immune response was detected after two doses of yeast-derived HBsAg (containing a total of 300 µg of HBsAg), whereas a primary immune response began after two feedings of the transgenic potatoes (which contained only a total of 85 µg of HBsAg). This apparent contradiction can be explained in light of the intracellular localization of the rHBsAg in potato. If rHBsAg is subject to degradation in the gut, the protein compartmentalized within plant cells would be protected by a natural “bioencapsulation.” It is relevant to note that mastication of food breaks it into smaller pieces, but the majority of plant cell degradation occurs in the intestines as a result of digestive of bacterial enzyme actions. They propose that the release of at least some rHBsAg from plant cells occurs near the Peyer's patches that function as mucosal immune effector sites. Further, we conclude that the particulate forms of rHBsAg that are evident in the plant cells may be especially immunogenic when released near these effector sites. Thus, “bioencapsulation” of the antigen may facilitate a more robust immune response. It is also possible that proteins or secondary metabolites (e.g., polyphenolics) may associate with HBsAg and account for its protection in the gastrointestinal tract, although we have no evidence to support this assertion. Further, proteinase inhibitors contained in potato tubers could slow proteolytic cleavage in the gut.
They also showed that HBsAg transgenic potatoes fed to mice could be used to boost an immune response. Mice primed with a single subimmunogenic parenteral dose of rHBsAg and fed potatoes containing HBsAg developed immediate antibody responses that peaked at >1,000 mIU/ml and were maintained at levels >200 mIU/ml for 5 months, when the experiment was terminated. In a practical context, these results provide a basis for a new immunization strategy, whereby only a single injection would be needed, followed by additional doses of orally delivered vaccine. This strategy could be a particularly useful approach to large-scale HBV immunization in developing countries where the logistics of multiple delivery doses of parenteral vaccine have hampered global HBV immunization efforts.
Both CT and Escherichia coli heat-labile enterotoxin (LT) are potent oral antigens and, in addition, provide adjuvant activity to antigens that are coadministered with them orally. Because the responses to potato HBsAg were much lower in the absence of CT, it is possible that an effective mucosal adjuvant will be needed for orally delivered material in human subjects. Although fully active native CT or LT will not be used in humans because of the risk of toxicity, there is a great potential for use of mutant forms with reduced toxicity that retain adjuvant activity. These altered toxins include active-site mutants LT-K63 and LT-R72 and the hinge cleavage mutant LT-G192. These previous reports show that LT can be an effective mucosal adjuvant when its toxic ADP- ribosyltrasferase activity is greatly attenuated. It should be noted that use of CT as a mucosal adjuvant does not abrogate tolerance already established against an antigen, and thus there is little chance that use of mutant CT or LT would cause food allergy.
By cooking the potatoes (boiling) before feeding the mice, we substantially reduced the immunogenicity of the vaccine. Most humans find raw potatoes unpalatable, which makes this particular plant an inappropriate delivery vehicle for an edible vaccine for humans. However, tomatoes and bananas are eaten raw and are grown widely, including in the developing world. HBsAg-transgenic tomatoes are currently being evaluated in experiments similar to those described in this paper.
The Need for a More Cost-Effective HBV Vaccine :- Despite the availability of a subunit vaccine for over a decade, HBV is still responsible for significant morbidity and mortality in poor countries. Oral immunization, because of its great convenience and patient compliance, represents a mode of delivery that could permit implementation of large-scale vaccination programs. However, to be adopted in an immunization program targeted to the people who need the vaccine the most, cost must also be a major consideration.
In the first 10 years of its use, yeast-derived HBV vaccine availability has been largely limited to the wealthy industrialized world. During the last decade, manufacturing processes improved, costs of production declined, and the vaccine has been adopted in some industrializing countries. More recently, revolving funds for vaccine procurement were established by the combined efforts of the World Health Organization, UNICEF, and philanthropic organizations. This effort has been highly effective in industrializing nations. An excellent example is the purchasing power of members of the Pan American Health Organization; however, even with this purchasing power, the most recent listed price of a single dose of rHBsAg vaccine is $0.90. This purchase price is more than the daily income of nearly one billion people, meaning that a further very significant cost reduction must be achieved if HBV immunization is to become sustainable without large contributions from donors. It is relevant to note that the Bill and Melinda Gates Foundation is making significant inroads to HBV delivery by philanthropic purchases of HBV vaccines. However, a truly sustainable strategy for global immunization will build on this philanthropic effort to create technology for indigenous production of vaccines, whenever possible, to ensure in-country vaccine production as national sustainable priorities.
In the current study, we have demonstrated that plant-based rHBsAg is an oral immunogen in mice. This finding must be verified in human trials, but it is of predictive value for anticipating how oral vaccines could be produced for HBV prevention. First, it is very likely that the quantity of HBsAg to be delivered orally must be higher than is used for parenteral delivery. Second, multiple doses will probably be needed. In combination, these requirements appear daunting if one were dealing with the current production costs for HBsAg produced by fermentation. However, the amount of HBsAg needed for one dose of an oral vaccine could be achieved in the contents of a single potato. In unpublished data (L.R., H.S.M., and C.J.A.), we have also found that high levels of HBsAg can be achieved in a single tomato, and candidate HBsAg-containing bananas are now in the seedling stage.
They are confident that plant-based “edible vaccines” can be developed. Two successful demonstrations of a prototype “edible vaccine” for diarrheal disease were demonstrated in human clinical trails. When potatoes containing the binding subunit of the heat-labile enterotoxin of E. coli (LT-B) were fed uncooked to volunteers, serum and secretory antibodies specific for LT-B were induced. In separate clinical studies, volunteers who ate uncooked potatoes containing the capsid protein of Norwalk virus (causal agent of epidemic gastroenteritis) developed both serum and secretory antibodies specific to the capsid protein. It is critical to note that both of the above immunogens are components of enteric pathogens, and hence their protein antigens may be special cases of gut-stable vaccine subunits.
Researchers have demonstrated here that HBsAg (a subunit antigen of a nonenteric pathogen) expressed in potato tubers and delivered to mice as an edible vaccine can stimulate serum antibodies specific for HBsAg at levels that very significantly exceed the protective level (in humans) of 10mIU/ml. The unique features of bioencapsulation of the antigen within plant cells may be the actual reason why plant based HBsAg is effective for oral immunization.
Abbreviations used
HBV: hepatitis B virus; HBsAg: hepatitis B surface antigen; rHBsAg: recombinant HBsAg; CT: cholera toxin; mIU: milli-International units; TEM: transmission electron microscopy; LT: heat-labile enterotoxin of E. coli.
B. Antigens For Vaccine Use Expressing HIV Tat Protein In Plants
The success of any future HIV-1 vaccine in combating AIDS will be dependent on economics and logistics of its delivery in the poorest and least developed countries in the world. To address this problem we exploit plants as safe and inexpensive delivery vehicles for components of a prospective HIV-1 vaccine. The tat protein has recently become a focus of vaccine research as a potential target for a broad, subtype-non-specific HIV-1 vaccine which may be suitable for harsh conditions in Africa. Tat has also been considered for vaccine-based therapies. We clone the tat gene of the MN strain of HIV-1 into a tobacco mosaic virus (TMV)-based vector, and developed plant-based production of the tat protein.
Several constructs were designed expressing either tat protein alone, or as fusions to a carrier protein. These chimeric TMV-derived vectors were shown to replicate successfully in inoculated leaves of Nicotiana benthamiana and spinach. The yield of tat protein expressed both in N. benthamiana and spinach plants was estimated to reach at least 330 micrograms of extractable protein per 1 gram of the leaf tissue. This plant-expressed tat protein fully retained immunological reactivity against a panel of tat-specific monoclonal antibodies. The availability of this plant-based, easily scalable production system, which can produce fully immunogenic tat protein is an important step toward HIV-1 vaccine.
The last five years have witnessed dramatic improvements in HIV-1 therapy which resulted in decline in deaths caused by AIDS in the developed world. However, despite these efforts the global picture of the AIDS pandemic continues to worsen. HIV-1 has brutally affected most of the developing countries, particularly in Africa, crippling their health care systems. The reasons for this worsening of the global HIV-1 pandemic go to the lack of prophylactic vaccines which the developing countries can afford. Due to many factors related to a peculiar virus life cycle, vaccines against HIV-1 are still in different stages of testing and research. Recent studies have suggested that HIV-1 Tat should be considered as an important component of potential HIV vaccines. The role of Tat is not only as a key regulator of HIV-1 replication in already infected cells, but also as a broad extracellular immunotoxin which increases efficiency of virus dissemination and promotes the AIDS progression. Inactive form of Tat, the so-called Tat-toxoid, demonstrated its vaccine potential in experiments on monkeys, and thus may be considered a good target for plant expression.
In recent years plants have been gradually explored as alternative bioreactors for production of biomedicals and vaccine components. The two main advantages of the plant systems are low cost and a greater potential for scalability as compared to microbial or animal systems. An additional advantage from the public health point of view is high safety, as compared to animal production systems, which is very important for vaccine production. At the same time edible plants may be used directly as delivery vehicles for different proteins protected in the cells like in microcapsules. Transient expression based on plant virus-based vectors has recently demonstrated its advantages over constitutive expression systems, due to high yield of expression, rapid accumulation of the products, and less time-consuming design of the expression constructs .
Antisera, conjugates, and monoclonal antibodies. The tat-specific monoclonal antibodies were obtained through the AIDS Research and Reference Reagent Program, AIDS Program, NIAID, NIH: HIV-1BH10 Tat monoclonal antibody from the Division of AIDS, NIAID; and monoclonal antibodies , NT8 8D1.8, NT7 7D5.1, and NT7 4A4.8 from Dr. Jonathan Karn. The polyclonal rabbit antiserum against alfalfa mosaic virus, conjugated to horseraddish peroxidase, was from Agdia, and was used according to the manufacturer’s instructions.
Primers and the gene assembly. The tat-gene from the MN isolate of HIV-1 was assembled from four overlapping synthetic primers:
tat1-(5’-ATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGT CAGCCTAAGACTGCTTGTACCACTTGCTATTG TAAAAAGTGTTGCTTTCAT-3’),
tat2-(5’TGGGGGGCGGGTTGCTTTGGTAGAGAAACTTGATGAGTCTGACTGTCTT CAGGAGCTCTTCGTCGCT-3’),
tat3-(5’-TTCAGGAGCTCTTCGTCGCTGTCTCCGCTTCTTCCTGCCATAGGAGATGCC TAAGGCTTTTTTTGTGAAACAAACT TGGCAATGAAAGCAACACTT-3’), and
tat4-(5’-CTAATCGACCGGATGTGTCTCTGTCTCTCTCTCCACCTTCTTCTTCGATTCC TTCGGGCCTGTCGGGTCCCCTCG GAACTGGGGGGCG GGTTGCTT-3’).
All four primers were mixed and subjected to 20 cycles of a regular PCR amplification. The resulting PCR products were separated in a low-melting-point agarose gel, and a diffuse DNA band of about 300 bp was cut and used as a template for PCR with the following two primers: #109 (+) 5’- GGTTTAATTAAAATGGAGCCAGTAGATC CTAG ACTA-3’, and #123 (-) 5’ -GGACTCGAGGATAT CCTCCACCTTCTTCTTCGA -3’. The resulting product of ca 280 bp was agarose-purified and cloned into the pTMV125C vector between PacI and XhoI sites resulting in the construct pTMV125C/tat. Fusions with the capsid protein of alfalfa mosaic virus (A1MV) were created by flanking the CP gene with EcoRV and XhoI sites and cloned into the pTMV125C/tat construct between EcoRV and XhoI sites downstream of and in-frame with the tat gene itself, resulting in the construct pTMV125C/tatCP.
Vectors, recombinant constructs, and plant inoculation. The tobacco mosaic virus-based vectors 30B and 125c were kindly provided by Prof. W.O. Dawson, University of Florida (Lake Alfred) as recombinant cDNAs plasmid clones. The artificially constructed cDNAs intended for expression were cloned into 30B or 125c vectors between PacI and XhoI sites, plasmids were linearized with the KpnI restriction enzyme, and transcribed in vitro using T7 RNA polymerase in the presence of the cap-analog m7GTP. The resulting capped RNA transcripts were inoculated into young leaves of 6 week old Nicotiana benthamiana or 4-week old spinach (Spinacea oleraceae).
Sampling of plants, and immunodetection of tat. Samples were collected from the infected plants 5 to 14 days post-inoculation. The plant proteins were analysed by electrophoresis using Laemmli’s Trisglycine-SDS system, and were subsequently electro blotted onto a nitrocellulose membrane. Expression of the tat and tat-related fusion proteins was tracked down by immunoblotting using either monoclonal antibodies specific to tat, and, in the case of the AMV CP fusions, polyclonal anti-AMV antibodies conjugated with alkaline phosphatase (Agdia, Elkhart, IN).
Expression of tat-coding proteins in N. benthamiana. Infectious transcripts of the two chimeric constructs, pTMV125C/tat and pTMV125C/tatCP were mechanically inoculated into young leaves of Nicotiana benthamiana plants. Expression of the tat alone and tat-containing fusions was tested by immunoblotting. At 6 days post-inoculation, the tat-CP fusion protein accumulated to a high level easily detected by immunoblotting with a tat-specific MAb, while tat alone accumulated to a much lesser degree. Both chimeric constructs caused mild symptoms in N. benthamiana, producing vein yellowing by day 5 post-inoculation, and slight to moderate stunting at 7-10 days post-inoculation. The level of accumulation of the tatCP fusion product depended on the age of the leaf at time of infection: when three sets of leaves were inoculated on the same plant, the youngest leaves consistently accumulated more protein. The tat protein, when fused to the AIMV CP, apparently interfered with the assembly of the virus particles and they could not purify virions from plants inoculated with pTMV125C/tatCP. However, the data obtained pointed out that plant virus-based vector can be successfully used for production of tat-fusion protein in plants, with the yield estimated based on Western-blot data about 330 mg of extractable protein per 1 g of infected leaf tissue.
This plant-expressed tat-fusion protein retained most if not all of the native tat immunologic properties as evidenced by its immunoreactivity against a tat-specific MAb, whether expressed in N. benthamiana, or in spinach. An extensive screening against five different MAbs specific for tat protein confirmed native or near native immunoreactivity of the tatCP fusion protein.
Our findings demonstrate that expression of tat using plant virus vectors is very efficient, quick and may be easily scaled up, while at the same time the tat protein produced retains immunological properties of the native tat. This is the first step for the production of HIV-1 vaccine components in plants.
C. An Edible Vaccine For Measles
The cultivation of plants with specific properties has been the foundation of medicine for millennia Modern biotechnology may one day extend their medicinal uses to include the delivery of vaccines.
Edible vaccines that are heat stable, easy to administer and cheap to produce have the potential to redress many of the production, distribution and delivery limitations faced by traditional vaccines.
Published data have shown that the concept of an edible vaccine is valid. Transition from a model system into a practical reality still has some way to go, including managing issues of oral tolerance, genetically modified organism safety, and effective vaccine doses.
Successful edible vaccines have the potential to transform health policy and practice in both developed and developing countries.
The success of immunisation strategies depends principally on reducing the susceptible proportion of the population to levels below which disease can remain endemic. Despite advances in medical science, the goal of herd immunity remains logistically, if not economically, unattainable for most of the world’s population, largely because of constraints on vaccine production, distribution and delivery.
One possible solution may be the production of edible vaccines grown in genetically modified food crops. Such plants could be grown locally, reducing costs, transport requirements, and dependence on foreign supply. Vaccine antigens expressed in plant storage organs, such as seeds, are frequently stable at room temperature, eliminating the need for refrigeration during transport and storage. Oral administration reduces the need for skilled personnel to give injections and negates concerns about the reuse of needles. In addition, oral vaccination may stimulate both systemic and mucosal immunity.
Another potential advantage is that, unlike live attenuated vaccines, plant-derived vaccines are subunit vaccines. They contain only a small part of the pathogen and are unable to establish an infection. This offers an additional level of vaccine safety, particulary for immunocom promised individuals. Subunit vaccines that are effective in the presence of maternal antibodies may also have benefits in preventing childhood infectious diseases.
Expression of bacterial and viral antigens in plants is well documented. In the first published clinical trial, volunteers were fed raw potato tubers expressing the binding subunit of an E.coli heat-labile enterotoxin. The serum antibodies produced by these volunteers were able to neutralise enterotoxic E.coli in vitro.
Edible vaccines are currently being developed for a number of human and animal diseases, including measles, cholera, foot and mouth disease, and hepatitis B and C. Many of these diseases are likely to require booster vaccinations or multiple antigens to induce and maintain protective immunity. Plants have the capacity to express more than one transgene, allowing delivery of multiple antigens for repeated inoculations.
However appealing, this technology is not without its hurdles. Many of the limitations, such as the accumulation of sufficient antigen in plants and questions of safety and oral tolerance, need to be addressed before vaccine plants can become a therapeutic option. Nonetheless, to illustrate the potential application of a plant - based vaccination system, here is the presentation of research work towards the development of an edible vaccine for measles.
C1. Why For Measles ?
Globally, measles causes over 800 000 deaths every year. Many other affected people become deaf or are weakened by pneumonia or encephalitis. The vaccine currently available for measles has been used effectively and safely since the 1960s and results in 95% seroconversion in individuals who are over the age of 18 months at the time of vaccination. However, the measles live - attenuated vaccine (LAV) has no oral efficacy and is destroyed by heat, so that its distribution and storage are dependent on maintenance of a “cold-chain” of refrigeration. Finally, the effectiveness of the LAV is reduced by the presence of maternal antibodies. These limitations present a serious challenge to the goal of measles eradication.
C2. Developing An Edible Measles Vaccine
The first stage in the development of an edible vaccine is selecting which antigen to express. Measles is an enveloped virus with two major surface proteins - the hemagglutinin (H) and fusion proteins. Antibodies raised to the H protein after infection with the wild-type measles virus (MV) have MV - neutralising activity and correlate with immunological protection. The H protein subunit from the attenuated Edmonston vaccine strain was therefore selected as the basis for an edible measles vaccine.
Transgenic plants may be generated by a number of methods. The most common uses Agrobacterium tumefaciens, a naturally occurring soil bacterium, to transfer a small segment of DNA into the plant genome in a process known as transformation. Whole plants can then be regenerated from individual plant cells that have been successfully transformed. Production of transgenic plants is species-dependent and can take from three to nine months.
By this method, we have successfully expressed the MV-H gene in the experimental model plant, tobacco. When given orally to mice, the transgenic plant extract containing the MV-H antigen induced serum antibodies that were able to neutralise wild-type MV-H in vitro, showing that plant -derived MV-H protein retains its immunogenicity. Researchers have recorded MV neutralisation titres, after oral vaccination of mice, which were five times greater then those considered protective in humans. Importantly, they have also documented the induction of MV-specific secretory IgA in faecal samples of mice vaccinated orally with plant - derived MV-H. Titres were found to be 3-729 times higher than in mice vaccinated with control plant extract (unpublished data). Secretory IgA is indicative of a mucosal immune response, which is important for protection against diseases that establish infection through mucosal surfaces such as the respiratory tract.
C3. From Model System To Vaccine Development
The next challenge will be to translate this technology from a model system into a vaccine.
Selecting a vaccine species : While tobacco is a good model system for evaluating the production of recombinant proteins, it produces toxic compounds which make it unsuitable for vaccine delivery. Clinical trials have shown the induction of immune responses with antigen expressed in potato and lettuce. Lettuce is a fast-growing species suitable for direct consumption and experimental studies. Another practical alternative may be rice, which is commonly used in baby food because of its low allergenicity. Recent studies have shown that mammalian proteins can be expressed to high levels in transgenic rice. Furthermore, rice is easy to store and transport, and protein expressed in rice grains is stable at room temperature. Rice flour can also be mixed with baby food, clean water or breast milk for delivery to infants. However, rice grown slowly and requires specialised glasshouse conditions, making it a restrictive species for preliminary studies. Future development will likely see the transformation of crop species such as rice for the delivery of vaccine antigens.
Oral antigen immunogenicity : Oral vaccination requires a higher antigen dose than either intranasal or parenteral vaccination. A question frequently asked is whether realistic quantities of edible plant material will be able to supply sufficient antigen to generate protective immunity. Three successful human clinical trials have shown that adequate doses of antigen can be achieved with plant-based vaccines. Preliminary analysis of MV-H transgenic lettuce plants produced in the laboratory suggests that 35-50 g of lettuce should be sufficient to deliver doses of MV-H protein comparable to those used in clinical trials (unpublished data).
However, as with a number of soluble protein antigens expressed in plants, the induction of consistent MV-specific immune responses following vaccination with plant extract currently requires the use of a mucosal adjuvant such as cholera toxin, which enhances immune responses at mucosal surfaces and reduces the oral dose required to induce an immune response. Inducing an immune response in the absence of adjuvants may be possible if antigen doses can be increased. Delivering the vaccine in intact plant material, rather than in plant extracts, may enhance antigen immunogenicity, as bioencapsulation of the antigen within the tough plant cell wall and membrane compartments can provide increased protection from intestinal degradation. High-level protein expression in seeds such as rice may also concentrate the antigen and further reduce dosing requirements. More research will be necessary to determine if enhanced antigenicity can replace the use of mucosal adjuvants.
Integration of edible vaccines into combined vaccine strategies
Immunisation strategies that combine different routes of administration or vaccine types frequently result in enhanced protective immune responses. Edible vaccines have considerable potential for use in such “prime-boost” strategies, particularly where multiple antigens or doses are required to induce immunity. For example, we found that a single-dose MV-H DNA inoculation followed by multiple MV-H boosters, delivered orally as a plant-derived vaccine could induce significantly greater quantities of MV-neturalising antibodies than vaccination with a DNA- or plant derived vaccine alone. Neutralisation titres up to 20 times greater than those considered protective in humans were achieved.”
C4. Safety Of An Edible Measle Vaccine
Will an edible MV vaccine induce oral tolerance? Conventional subunit vaccines have not been associated with oral tolerance. However, repeated exposure to an oral antigen has the potential to produce immunological tolerance. The induction of oral tolerance is both time-dependent and dose-dependent. The antigen dose necessary to induce protection is generally smaller than that required to produce tolerance. In addition, repeated or continuous exposure is usually necessary to induce tolerance. Expression of vaccines in commonly consumed foods does not mean that they will become a component of regular diets. As medicines, edible vaccines should be administered appropriately. In this setting, we believe it is unlikely that an edible vaccine would lead to oral tolerance. However, this remains an area of vaccine development that needs to be closely monitored.
Other health issues: Recent evidence has also shown that vaccination with MV-H-subunit vaccines is unlikely to prime for “a typical” measles, as was seen after use of the formalin-inactivated, alum-precipitated measles vaccine in the 1960s. While current measles vaccination programs may indirectly facilitate the emergence of vaccine-modified measles as a result of waning immunity, a cheap, edible vaccine available to both infants and young adults as part of a revaccination program has the potential to contribute to the overall eradication of measles.
The genetically modified organism (GMO) debate : Edible vaccines are genetically modified plants (organisms), and, as such, they are linked with the public debate surrounding genetically modified food. The variety of genes that are inserted into plants means that no two GMOs are the same. The MV-H gene we used is derived from the attenuated Edmonston vaccine strain. The MV-H protein has no known inherent toxicity and MV-H-subunit vaccines have been safely trialled in mice and primates. Plant derived MV-H protein has similar immunogenicity to MV-H protein from mammalian cell culture, and no MV-H-specific toxicity has been observed in mice or baboons fed MV-H plant extract. Therefore, we believe this antigen, produced by plants, is safe for human consumption and potentially safer than the measles live attenuated vaccine.
Although the risk of recombination with wild-type MV is low, if this should occur the Edmonston strain H gene would only serve to attenuate the wild-type strain. In addition, plant-derived MV-H is anchored in the endoplasmic reticulum, preventing transfer to its native position on the virus surface.
The potential environmental impact of MV-H transgenic plants is currently unclear, although the MV-H gene is not expected to confer a selective advantage on transgenic plants. Concerns about transfer of genes to nontarget organisms remain to be addressed. However, it is likely that advances in plant biotechnology over the next decade will confront many of these issues. One such advance is the development of chloroplast transformation. In most plant species, the chloroplast genome is maternally inherited. This means that the transgene and any protein expressed following chloroplast transformation are not present in pollen, thereby reducing the risk of transmission of the transgene to neighbouring crops or weed species by cross-pollination. Expression of transgenes from the chloroplast genome may also result in the accumulation of significantly greater quantities of protein.
