GodAandScience.org

Recent Problems in Evolution

Studies published over the last few years (1990-2001) have demonstrated increasing numbers of problems associated with the theory of evolution. These studies have been done by scientists that believe that the theory of evolution is true. To a large degree, they represent a small amount of the "negative" research in evolutionary studies. Most investigators are not willing to submit a manuscript for publication that contradicts the current dogma. Reviewers of such manuscripts are unlikely to accept a negative study for publication unless a suitable alternate hypothesis is stated and supported by extensive data.

Table of Contents (listed by date)

2001

2000

1999

1998

1997

1996

1995

1994

1993

1992

1991

1990

Discrepancy of genetic and fossil appearance dates of vertebrates

Paleontologists believe that vertebrates diverged from a lancelet-like relative sometime in the Cambrian period, which began 545 million years ago. However, molecular studies of gene similarities between lancelets and today's vertebrates suggest that the vertebrate lineage diverged 750 million years ago. Recent fossil finds do not resolve this discrepancy. Haikouella, sliver-shaped lancelet-like organisms that have eyes and probably have a primitive brain, have been dated to 530 million years ago. Recently discovered conodonts, previously classified into a number of different phyla, seem to be full-fledged vertebrates, even more similar to living jawed fish than to lampreys or hagfish. However, these fossils date to 510 million years ago at the earliest.

Zimmer, C. 2000. In Search of Vertebrate Origins: Beyond Brain and Bone. Science 287: 1576-1579.

back

Neanderthal baby attacks evolutionary dogma

Stepping out 29,000 years from the past, a Neanderthal baby has taught evolutionists a thing or two about human origins, and strengthened the case for special creation. In a just published study, scientists extracted mtDNA from a Neanderthal infant skeleton found in the northern Caucasus near the Black Sea and laid to rest any question of whether Neanderthals could have been our ancestors. A previous study had examined a 397 base pair Neanderthal mtDNA fragment and compared it with a mtDNA sequence of 986 nucleotide pairs from living humans of diverse ethnic backgrounds. The results showed an enormous 26 nucleotide base pair difference between the Neanderthal and Human mtDNA (a 6.5% difference, which is almost as much as the average difference between human mtDNA and chimpanzee mtDNA, which is 8.9%) (29). In this region of the mtDNA, modern humans differ from one another in an average of eight base pairs, and those differences were completely independent of the 26 observed for the Neanderthal fossil. In the current study, a 357 base pair sequence of mtDNA was examined and found to vary from modern human sequences at 23 bases (6.4%), nineteen of which were identical to those of the first Neanderthal. A summary of the findings of the two studies can be found in the table below:

Sequence Differences Between Modern Humans and Neanderthals
mtDNA
Sample

Sequence Number (Read Down)
11111111111111111111111111111111111111
66666666666666666666666666666666666666
00001111111111111122222222222222333333
37890011123455688802334455566679124669
78637812899846923993043408612389104253

Modern
Human
AATTCCCCGGACTGCAATTCACTGCCACC-CATCCTCC
Neanderthal1 GG.CTTTT.ATTC.T.CCCTGT.A.GA.TATGCT.C..
Neanderthal2  .C......ATT.ATCCCCTGT.A.A..TATGCTTC..

The analysis of the infant's DNA was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neanderthal disappeared. If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neanderthals. In addition, since the two Neanderthal fossils were separated geographically by over 2,500 km, it shows that Neanderthals were a homogeneous species that was distinct from ancient humans. In fact, the differences in mtDNA sequences compared to modern humans were so great that calculations indicated that the last common ancestor between modern man and Neanderthal must have been at least 365,000-850,000 years ago.

Igor V. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: 490-493.

back

Little diversity among Neanderthals

Sequencing of a third Neanderthal specimen demonstrated that the three specimens were closely related (differing by only a few bases) although they were separated by over 1000 miles and died tens of thousands of years apart. Although the differences between modern humans and Neanderthals are large (>6%), the differences among individual humans or among individual Neanderthals is small compared to other apes (see table below). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate a creation model, but does indicate that those creatures were created well before modern humans.

mtDNA Sequence Variation Among Species (31)
Population Individuals Mean Minimum Maximum s.d.
Neanderthals 0,003 03.73 - - -
Humans 5,530 03.43 0.00 10.16 1.21
Chimpanzees  0,359 14.81 0.00 29.06 5.70
Gorillas 0,028 18.57 0.40 28.79 5.26

Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. P��bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.

back

Little Sequence Variation Among Ancient Anatomically Modern Humans

Previous studies have shown that there are large difference in sequences of mtDNA between modern humans and Neanderthals. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first study to examine the mtDNA sequence of ancient anatomically modern humans was published in 2001, examining the mtDNA sequences of 10 ancient Australians. A summary of the HVR-1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in the table, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 sequence sharing similarity to a portion of chromosome 11 in modern humans (thought to have been inserted into the human genome from the mtDNA). The authors concluded that the "loss" of the ancient mtDNA variation seen in LM3 could explain how Neanderthals do not share mtDNA with modern humans. Although it is certainly possible that part of mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the mtDNA of LM3 was "lost." In fact, of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals.

mtDNA Sequence Variation of Ancient, Anatomically Modern Humans
mtDNA Sample
(HVR-1)
Age
(ka)

Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817

Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 62 ....................T.G...........CT.T....T..T......TC....G
LM4 <10 .................T...........G................C............
LM15 0.2 ....................T........................T.......C....G
LM55 <10 ...........G.......................T.......................
KS1 10 .C............T.....T.........................CG..T........
KS7 8 ..............T.....T..................T...........C.......
KS8 8-15 ....................T.G..............TG.......C............
KS9 9 .C..................T..............T............C.........G
KS13 8-15 .C............T.....T....C.G.................TC............
KS16 9-15 ....................T...................T.............C..C.
*mtDNA HVR-1

Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542.

back

Modern humans hands down winners over Neanderthals

Another critical anatomical difference has been found between Neanderthals and contemporary ancient humans. Wesley Niewoehner, an anthropologist at the University of New Mexico in Albuquerque has built 3D digital maps of the surfaces of the metacarpals, the bones that make up the palm of the hand, from Neanderthals and ancient humans. The shapes of the ends of the metacarpals reflect the kind of grip these creatures had. Niewhoehner�s maps suggest that the smaller, slimmer hands of early modern humans were better suited to oblique grips - used when holding a complex tool with a handle, such as a hammer. Neanderthals, by comparison, were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthals would have prevented them from engaging in fine motor skills, such as carving and painting. The more sophisticated use of tools by early modern humans would have given them a great survival advantage over Neanderthals, possibly leading to the extinction of the Neanderthals.

Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature.
Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences.

back

Another blow to multiregional evolutionary theory

The multiregional evolutionary theory claims that humans are descended from multiple hominid forms (Neanderthals, Homo erectus, etc.). Recently, proponents of this theory have claimed that fossils show that an archaic Homo erectus from Java shared key features with living Asians and early modern humans in Australia. Their conclusion was that Asian H. erectus passed on some of its DNA to modern Australians and Asians (Science, 12 January 2001, p. 293). A recent genetic analysis of Asians, however, explodes this theory. The study, examining more than 1000 Asian men, determined that all of these men came from one source, between 35,000 and 89,000 years ago. The study is so convincing that some multiregional evolutionists have now dropped this theory. At the annual meeting of physical anthropologists in Kansas City, Missouri, one self-described "dedicated multiregionalist," Vince Sarich of the University of California, Berkeley, admitted: 

"I have undergone a conversion--a sort of epiphany. There are no old Y chromosome lineages [in living humans]. There are no old mtDNA lineages. Period. It was a total replacement."

Gibbons, A. 2001. Modern Men Trace Ancestry to African Migrants. Science 292: 1051-1052.
Yuehai Ke, et al. 2001. African Origin of Modern Humans in East Asia: A Tale of 12,000 Y Chromosomes. Science 292: 1151-1153.

back

Fully formed crustacean found from the early Cambrian

In a huge setback for evolutionists, scientists have discovered a true crustacean in early Cambrian strata from Shropshire, England. In a recent issue of Science, Drs. Siveter, Williams, and Waloszek. announced the discovery of a fossil phosphatocopid ostracod, which is preserved extraordinarily well, including all its delicate limbs cast in calcium phosphate, clearly allowing it to be classified as a crustacean. Very few fossils of this great antiquity reveal so much detail or can be interpreted with such certainty. Although the discovery is clearly at odds with evolutionary theory, an analysis in the same issue by Dr. Richard Fortey comes to the remarkable conclusion that this discovery explodes the Cambrian explosion. Dr. Fortey believes that this discovery will foreshadow the discovery of precursor organisms from the pre-Cambrian. Of course, the fact that this has not happened yet does not hinder the evolutionists from wildly speculating that the Cambrian explosion will be overturned. Dr. Fortey does make a rather telling admission at the end of the article (followed by the usual party line):

"Even if evidence for an earlier origin is discovered, it remains a challenge to explain why so many animals should have increased in size and acquired shells within so short a time at the base of the Cambrian. At the moment, there are almost as many explanations as there are animals caught in this belated "explosion." But it is more than likely that the evolutionary fuse was lit long before the Cambrian."

D. J. Siveter, M. Williams, and D. Waloszek. 2001. Science 293: 479.
Fortey, R. 2001. The Cambrian Explosion Exploded? Science 293: 438-439.

back

Phylogeny of enolase does not match evolutionary models

The presence of similar genes across widely diverse organisms is contrary to standard evolutionary theory.

Concluding Remarks. The shared presence of homologous insertions in the enolases of apicomplexan parasites and land plants has little or no relationship to the presence of a plastid in apicomplexa. Rather, the distribution of insertions in enolase and the phylogeny of enolase are at odds with one another, a phenomenon with more far-reaching implications on how we perceive gene and genome evolution and molecular phylogeny. First, insertions and deletions are not unconditionally reliable markers of evolutionary relationships; even if free of homoplasy, they can, indeed, be transmitted between lineages more or less independently of the genes in which they are situated. This observation does not negate the use of insertions or deletions to reconstruct ancient events, but does emphasize the need to weigh the merit of such characters in conjunction with the phylogeny of the gene in which they are found (27, 42�45) and with other external information (46). Second, if alveolate enolases are products of recombination, it is doubtful that this recombination happened because these insertions were present. Rather, it is likely that it was detected only because the insertions act as a flag, drawing attention to the incongruent evolutionary histories between different parts of the gene. It follows that subgene-level recent years has been the importance of lateral gene transfer. Some have argued that ancient lateral transfer between genomes has led to a tree of life that does not branch like an ordinary tree, but rather weaves a web of diverging and intersecting branches that has smudged any crisp phylogenetic definition of the genome (5, 6). If the insertions were indeed transmitted horizontally between two distantly related genes, then evolutionarily distant lateral transfer can be extended to the subgene level, which, in turn, suggests that individual gene trees also may be reticulate in nature at the most ancient levels. As lateral gene transfer raised questions as to the phylogenetic definition of the genome, enolase raises new questions as to the phylogenetic definition of the gene itself.


Home | Apologetics | Answers | Love | Slideshow | Evolution/Design | Discussion
Personal | Webmaster | General | Doctrine | Cults | Discovery | Young-Earth | Search

Last updated 10/09/01

Hosted by www.Geocities.ws

1