GodAandScience.org

Descent of Man Theory: Disproved by Molecular Biology
by Richard Deem

Introduction

The current theory of human evolution states that modern humans evolved from more primitive bipedal hominids. The first bipedal hominid genus that is supposedly the ancestor of modern humans is Australopithecus, which appeared in the fossil record from about 4.4 to 1 million years ago throughout eastern Africa. Australopithecus comprised a diverse group of small-brained bipedal species that were confined to the savannas of Africa. This genus was supposed to have evolved into the genus  Homo, which has been defined as bipedal primates with a brain capacity over 700 cc, having appeared in the fossil record by about 2 million years ago as Homo habilis in eastern Africa. According to theory, Homo habilis evolved into Homo erectus, which had a brain capacity just over 1000 cc, appearing in the fossil record from about 1.5 million to 300 thousand years ago. Homo neandertalensis lived between 400 and 28 thousand years ago. Archaic Homo sapiens appeared 400 - 150 thousand years ago, and modern Homo sapiens from less than 100 thousand years ago. Contrary to the claims of many creationists, there is ample evidence for the existence of human-like species of bipedal primates. The dates and ages of these fossils are not widely disputed in scientific circles. The reality of the fossil record and the reliability of the dates of these fossils is actually instrumental in disproving the descent of man theory. If the fossil record were not as complete as it now is, the standard evolutionist argument would apply, "we just haven't found the missing link ancestor of modern humans yet."

The beginning of trouble - lack of genetic diversity among modern humans

As evolutionists studied humans and species of apes in the 1970's and 1980's, some rather surprising information was being discovered that distinguished us from apes and other primates. The maximum Fst value (a measure of variation between population groups) between human races is 0.08 (1, 2). However, among populations of chimps, orangutans, and other primate species, Fst values are commonly more than 0.20. An examination of 62 common protein coding genetic loci, indicates a substitution rate of 0.011/locus (Caucasoids versus Mongoloids), to a maximum of 0.029 (Mongoloids versus Negroids). However, in nearly all other animal species studied, including apes, usually exceed 0.05 (2). In humans, heterozygosity (the proportion of alleles that are polymorphic, in this case within the species) is 1.8% , whereas in apes it ranges from 2.5 in the Orangutan to 3.9 in the Chimpanzee (3). An analysis of the genetics of  populations of apes reveals that different population groups possess fixed novel mutations that characterize each population. In contrast, there are no novel mutations or genetic alleles that specifically characterize any one human race from another. More recent studies have confirmed the early work, likewise showing that human genetic diversity is far less than what one would predict from Darwinian theory. Dr. Maryellen Ruvolo (Harvard University) has noted, "It's a mystery none of us can explain." (4). Examinations of the genetic sequences of diverse modern human populations reveals minor, if any differences (5). All of this evidence suggested a recent origin for modern humans.

Still more trouble - Discontinuous morphological changes in the hominid lineage

braincapac.gif (2725 bytes)Paleontological discoveries and geochronology show that the pattern of morphological change in the hominid fossil record was not progressive, but abrupt (6). Some adaptations essential to bipedalism appeared early, but others appeared much later. Although the 3.2 million year old fossil "Lucy" (Australopithecus afarensis), was said to be bipedal, her 2.6 million year old descendent, Australopithecus africanus, was indisputably arboreal (7). Primitive craniodental complexes (similar to the reconstructed last common ancestor with the African great apes) were found in nearly all species of Hominidae (8). Relative brain size increased slightly among successively younger species of Australopithecines, although many Australopithecine skulls have brain capacities no larger than those of chimpanzees. (9, 10). However, brain capacities expanded abruptly with the appearance of Homo, but within early Homo remained at about half the size of Homo sapiens for almost a million years. The fossil record indicates an accumulation of relatively rapid shifts in successive species, and certainly not any kind of gradualistic changes.

Another problem - too many deleterious mutations

A recent study examined the mutation rate for humans. Using "conservative assumptions" the authors found that the overall mutation rates was 4.2 mutations per person per generation, with a deleterious rate of 1.6 (11). When using more realistic assumptions the overall mutation rate for humans become 6.7 with a deleterious rate of 3.1. Such a high rate should have resulted in extinction of our species long ago. They stated in their conclusion:

"The deleterious mutation rate appears to be so high in humans and our close relatives that it is doubtful that such species, which have low reproductive rates, could survive if mutational effects on fitness were to combine in a multiplicative way."

The authors had to rely upon a rare association of mutations, termed synergistic epistasis to explain why the numerous hypothesized deleterious mutations have not overwhelmed our genome. Instead of postulating the obvious (that the human genome is not as old as evolution would teach), evolutionists must rely upon the improbable to retain the evolutionary paradigm.

Recent origin of modern humans confirmed through molecular biology

Mitochondrial DNA (mtDNA)
In the late 1980's and early 1990's a number of studies were done examining the mitochondrial DNA (mtDNA) of women all over the world. These studies, nicknamed the "Eve theory," suggested that the last common ancestor of modern man (actually women) appeared within the last 200,000 years (12-15), much more recently than previously thought. Refinements in the measurements lowered the original estimates to 135,000 years (15) and finally 100,000 years (19). Scientists chose to examine mtDNA because, being enclosed within the subcellular organelle called the mitochondrion, there is no genetic recombination (males make no contribution of mtDNA to the fetus). All mtDNA comes from our mothers and is passed down from mother to daughter, since only mitochondria from the egg are used to make up the fetus. By tracing the differences in mtDNA from peoples around the world, scientists have calculated the probable date of the last common ancestor of modern humans at 100,000 to 200,000 years ago.

Y-chromosome analysis
In 1995, scientists have examined human origins from the perspective of male genetics (16, 17). Scientists have examined a gene (ZFY), which being on the Y chromosome, is passed down only from father to son. Thirty-eight men were chosen from all over the world (Africa, Asia, Australia, Europe, and Northern, Central, and South America). Scientists determined the actual genetic sequence in each man for this gene, which is 729 base pairs long. To their surprise, all men had identical genetic sequences (over 27,000 base pairs analyzed). Scientists have calculated the most probable date for the last common ancestor of modern man, given the sequence diversity from modern apes. Using two different models this date is either 270,000 or 27,000 years ago. However, both these models assume that the male population during this entire period of time consisted of only 7,500 individuals. The date estimates from these models would be significantly reduced if the male population were higher than 7,500, which is very likely. Two separate studies using similar techniques looked at larger pieces of the Y chromosome, which would reduce the uncertainty in the calculation of dates. One study examined a gene which was 2,600 base pairs and determined a last common ancestor date of 188,000 year ago (minimum of 51,000 and maximum of 411,000 years ago) (18). The other study used a very large piece of the Y chromosome (18,300 base pairs) and calculated a last common ancestor date of modern man of 43,000 years ago (minimum of 37,000 and maximum of 49,000 years ago) (19). This latter study also examined mitochondrial DNA from women and determined an origination date of 90,000-120,000 years ago.

Linkage disequilibrium analysis
A studied published in 1996 (20) examined linkage disequilibrium at the human CD4 locus (a T-cell associated antigen) as a means to establish the date of modern human origins. This study determined a maximum origin date of 102,000 years ago based upon the assumption that the Alu (-) allele arose 5 million years ago, or almost immediately after mankind's split from other primates. As they stated, "It is likely that the Alu deletion event occurred more recently, in which case our estimates for the date of founding of the non-African populations would also be more recent." Preliminary studies from chromosomes 19, 11 and 8 show similar results to that seen on chromosome 12 (the locus of the CD4 gene) (21).

Using rare mutations to estimate population divergence times
A study published in December, 1998 examined population divergence time using rare mutations between populations to estimate divergence among three Mediterranean populations. The results indicated that Danish people (who are my ancestors) would have diverged from the other groups, at most, 4,500 to 15,000 years ago (22). This number does not necessarily help us establish a date for the appearance of modern humans, but it is likely that future studies in this area (this is one of the first published) may provide accurate numbers for the appearance of human populations in different areas of the world and a lower limit to the date of appearance of modern humans.

The nail in the coffin

Therefore, the most accurate date (see note below) for the origin of modern humans indicate that the last common ancestor to modern humans must have existed less than 50,000 years ago (19). Such a recent date left only one potential ancestor for modern humans, that is, Homo neandertalensis (Neanderthals), which lived between 400,000 and 28,000 years ago. Previous anatomical studies had cast doubt on the possibility of Neanderthals being the ancestors of modern humans (23-27). These studies showed differences in Neanderthal's brain case (23) and the presence of an internal nasal margin, a medial swelling of the lateral nasal wall, and a lack of an ossified roof over the lacrimal groove (24-25). None of these features are found in Homo Sapiens, and the last feature is not found in any other terrestrial mammal! A recent analysis of Neanderthal hands has revealed that modern humans and Neanderthals differed markedly in the kind of grip they could use (26). Neanderthals were limited to grips as one has when holding a stone or baseball. Such a grip would have been powerful (you wouldn't want to shake hands with a Neanderthal), but not very dexterous. The anatomy of the Neanderthal's hands would have prevented them from engaging in fine motor skills, such as carving and painting. Neanderthals had a huge nasal cavity coupled with a brain size larger than our own. However, with their carnivorous lifestyle, it seems likely that much of their brain might have been devoted to the sense of smell, being the "dog" among the hominids (27).

In brilliantly designed and executed independent studies, scientists have extracted mtDNA from three Neanderthal skeletons; one from Neander Valley in Germany, another from the northern Caucasus near the Black Sea, and the third in Vindija Cave, Croatia, and laid to rest any question of whether Neanderthals could have been our ancestors (28-30). The first study examined a 397 base pair Neanderthal mtDNA fragment and compared it with a mtDNA sequence of 986 nucleotide pairs from living humans of diverse ethnic backgrounds. The results (Table 1) showed an enormous 26 nucleotide base pair difference between the Neanderthal and Human mtDNA (a 6.5% difference) (31). In this region of the mtDNA, modern humans differ from one another in an average of eight base pairs, and those differences were completely independent of the 26 observed for the Neanderthal fossil. However, many of the sequence variations found in the Neanderthals were shared in the Chimpanzee. A 357 base pair sequence of mtDNA was examined from the second Neanderthal fossil and was found to vary from modern human sequences at 23 bases (6.4%), nineteen of which were identical to those of the first Neanderthal. The third Neanderthal differed from modern humans by 26 bases, 23 of which matched the first Neanderthal and 20 of which matched the second specimen. A summary of the findings of the two studies can be found in Table 1, below.

Table 1. Sequence Differences* Between Modern Humans and Neanderthals

mtDNA Sample
(HVR-1)

Sequence Number (Read Down)
111111111111111111111111111111111
666666666666666666666666666666666
000011111111111112222222222223333
378900112345568880233455666791246
786378129984692399304468123891042

Modern Human AATTCCCCGACTGCAATTCACGCACC-CATCCT
Chimpanzee ......T.ATT.....ACTGAAA.....G....
Neanderthal #1 GG.CTTTTATTC.T.CCCTGTAAG.TATGCT.C
Neanderthal #2  .C.....ATT.ATCCCCTGTAA..TATGCTTC
Neanderthal #3 GG......ATTC.TCCCCTGTAAG.TATGCT.C
*mtDNA HVR-1

The analysis of the second sample was extremely important, since it was dated at 29,000 years ago - only 1000 years before the last Neanderthal disappeared (32). If Neanderthals and humans had interbred, one should have expected to see this in the last remnants of the Neanderthals. In addition, since the Neanderthal fossils were separated geographically by over 2,500 km, it shows that Neanderthals were a homogeneous species. The researchers conclusion: "Neanderthals were not our ancestors" - a quote from the authors of the first study. In fact, the differences between modern humans and Neanderthals were so great that calculations indicated that the last common ancestor (according to evolutionary theory) must have existed 550,000 to 690,000 years ago (first study) and 365,000 to 853,000 years ago (second study).

Although the differences between modern humans and Neanderthals are large, the differences among individual humans or among individual Neanderthals is small compared to other apes (Table 2). Such low genetic diversity among Neanderthals are consistent with a creation model in which Neanderthals were specially created as a small population in the relatively recent past. The much larger variation seen among chimpanzees and gorillas does not eliminate them as specially created, but does place their probable creation date considerably before that of modern humans.

Table 2. mtDNA Sequence Variation Among Species (30)
Population Individuals Mean Minimum Maximum s.d.
Neanderthals 0,003 03.73 - - -
Humans 5,530 03.43 0.00 10.16 1.21
Chimpanzees  0,359 14.81 0.00 29.06 5.70
Gorillas 0,028 18.57 0.40 28.79 5.26

Ancient Anatomically Modern Humans - the missing evidence

Knowing the variation of sequences between modern humans and Neanderthals is important in determining if Neanderthals contributed to the human gene pool. However, without a measure of the variation among ancient anatomically modern humans and between them and modern humans, the data is incomplete. The first of these studies was published in 2001, examining the mtDNA sequences of 10 ancient Australians (33). A summary of the HVR-1 sequence of these individuals (compared with the modern human reference sequence, modern Aboriginal polymorphism, Neanderthals, and chimpanzees) can be found in Table 3, below. The first thing that one notices is that the sequence variation of ancient humans compared to modern humans is at most 10 base pairs (in LM3, the most ancient specimen). As stated previously, the average variation among population groups of modern humans is 8 base pairs. LM3, dated at 62,000 years old, varied the most from the modern human reference sequence, but this variation included only three bases shared with Neanderthal specimens. Since LM3 was a contemporary (or lived even earlier than the Neanderthals sequenced to date), it is apparent that the human genome was already nearly "modern" before Neanderthals died out. The authors of the study made a big deal about the LM3 sequence sharing similarity to a portion of chromosome 11 in modern humans (thought to have been inserted into the human genome from the mtDNA). The authors concluded that the "loss" of the ancient mtDNA variation seen in LM3 could explain how Neanderthals do not share mtDNA with modern humans. Although it is certainly possible that part of mtDNA might find its way into the nuclear genome, it doesn't address the issue of how the variation seen in the mtDNA of LM3 was "lost." In fact, of the ten sequence differences between LM3 and the modern human reference sequence, five of those bases correspond to polymorphisms found in modern Aboriginal people, showing that those five bases were not lost at all. This leaves only a five base difference, certainly within the range of that found among modern humans. Overall, the lack of "evolution" for humans over the last 60,000 years stands in sharp contrast to the large differences seen between modern humans and Neanderthals. European evolutionists have also disputed the claims of Adcock et al. in the journal Science in June, 2001. More information on this can be found in the paper, New DNA Evidence Supports Multiregional Evolutionary Model?

Table 3. mtDNA Sequence Variation of Ancient, Anatomically Modern Humans (33)
mtDNA Sample
(HVR-1)
Age
(ka)

Sequence Number (Read Down)
00111111111111111222222222222222222222222222233333333333333
79001122345668889001223344444555566677888899901112345556688
83781269984393499198340413479368923448467803911780715672817

Modern Human 0 ATCCCCTGACTACACTTCTCCTACATGATACACCTCGCACCTCAACTAACCTCTTTTTA
Aboriginal 0 ......CA......TC..CTT...T.....TC..CTA...T.T.G.C..TT.TC.C...
Bonobo 0 ......CAT...T..CCTA.TCGA.CACCAA...C.......AG..CCCT..A.CCC..
Chimpanzee 0 ....T..ATT.....AA.C.TCGA.CA...A......TG....CG..CT.T.T.C.C..
Neanderthal #1 30+ GCTTTT.ATTC.T-.CC.C.T.GT..A...AG.T...T......G.C..T.....C...
LM3 62 ....................T.G...........CT.T....T..T......TC....G
LM4 <10 .................T...........G................C............
LM15 0.2 ....................T........................T.......C....G
LM55 <10 ...........G.......................T.......................
KS1 10 .C............T.....T.........................CG..T........
KS7 8 ..............T.....T..................T...........C.......
KS8 8-15 ....................T.G..............TG.......C............
KS9 9 .C..................T..............T............C.........G
KS13 8-15 .C............T.....T....C.G.................TC............
KS16 9-15 ....................T...................T.............C..C.
*mtDNA HVR-1

 

The bottom line

There are two currently popular theories of human evolution 1) a single recent appearance of modern humans and 2) the multiregional model, which states that modern humans evolved simultaneously on different continents. Molecular biology destroys the multiregional model (12-22, 28-33). In addition, even the fossil evidence does not support the multiregional model (34). Instead, all the data supports the biblical view that humanity arose in one geographical locale. Modern molecular biology tells us that modern humans arose less than 100,000 years ago (confirmed by three independent techniques), and most likely, less than 50,000 years ago (12-22). This data ties in quite well with the fossil record. Sophisticated works of art first appear in the fossil record about 40,000-50,000 years ago (35) and evidence of religious expression appears only 25,000-50,000 years ago (36, 37). Other indications of rapid changes during the Middle-Upper Paleolithic transition (35, 000 to 45, 000 years ago) in Europe include (38):

Simultaneous, rapid changes in human abilities suggest replacement of previously existing hominids with modern humans. The fact that all these events happened ~50,000 years ago precludes any possibility that previously existing hominids could be our ancestors, since Homo erectus died out 300,000 years ago, and Homo neandertalensis has been proven to be too genetically different from us to have been our ancestor (28, 29). Where does this leave the evolutionists and their descent of man theory? Well, they can always fall back on their favorite line - "the fossil record is just incomplete." Alternatively, check out Genesis 1:26.


References

  1. R. Lewontin 1972. The apportionment of human diversity. Evolutionary Biology 6: 381-398
  2. M. Nei and A. K. Roychoudhury. 1982. Genetic relationship and evolution of human races. Evolutionary Biology 14: 1-59
  3. Janczewski DN. Goldman D. O'Brien SJ. 1990. Molecular genetic divergence of orangutan (Pongo pygmaeus) subspecies based on isozyme and two-dimensional gel electrophoresis. Journal of Heredity 81: 375-387
  4. Gibbons, A. 1995. The mystery of humanity's missing mutations. Science 267: 35-36.
  5. Pult I, Sajantila A, Simanainen J, Georgiev O, Schaffner W, Paabo S. 1994. Mitochondrial DNA sequences from Switzerland reveal striking homogeneity of European populations. Biol Chem Hoppe Seyler 375: 837-840
  6. Wood B. 1992. Origin and evolution of the genus Homo. Nature 355: 783-790.
  7. Shreeve, J. 1996. New skeleton gives path from trees to ground an odd turn. Science 272: 654
  8. McHenry H.M. 1994. Body size and proportions in early hominids. Proceedings of the National Academy of Sciences of the United States of America 91: 6780-6786.
  9. Dean Falk. 1998. Hominid brain evolution: looks can be deceiving. Science 280: 1714
  10. Conroy, G.C., G.W. Weber, H. Seidler, P.V. Tobias, A. Kane, and B. Brunsden. 1998. Endocranial capacity in an early hominid cranium from Sterkfontein, South Africa. Science 280: 1730-1731.
  11. Eyre-Walker, A. & Keightley, P. D. 1999. High genomic deleterious mutation rates in hominids. Nature 397, 344-347.
  12. R.L. Cann, M. Stoneking, A.C. Wilson. 1987. Mitochondrial DNA and human evolution. Nature 325: 31.
  13. L. Vigilant, M. Stoneking, A.C. Harpending, K. Hawkes, A.C. Wilson. 1991. African populations and the evolution of human mitochondrial DNA. Science 253: 1503.
  14. M. Hasegawa, S. Horai. 1991. Time of the deepest root for polymorphism in human mitochondrial DNA. J. Mol. Evol. 32: 37.
  15. Stoneking M, Sherry ST, Redd AJ, Vigilant L. 1992. New approaches to dating suggest a recent age for the human mtDNA ancestor. Philos. Trans. R. Soc. Lond. B Biol. Sci. 337: 167-175.
  16. S. Paabo. 1995. The Y chromosome and the origin of all of us (men). Science 268: 1141.
  17. R.L. Dorit, H. Akashi, W. Gilbert. 1995. Absence of polymorphism at the ZFY locus on the human Y chromosome. Science 268: 1183.
  18. Hammer, M.F. 1995. A recent common ancestry for human Y chromosomes. Nature 378: 376-378.
  19. Whitfield, L.S., J.E. Suston, and P.N. Goodfellow. 1995. Sequence variation of the human Y chromosome. Nature 378: 379-380.
  20. Tishkoff, S.A., E. Dietzsch, W. Speed, A.J. Pakstis, J.R. Kidd, K. Cheung, B. Bonn-Tamir, A.S. Santachiara-Benerecetti, P. Moral, M. Krings, S. Paabo, E. Watson, N. Risch, T. Jenkins, and K.K. Kidd. 1996. Global patterns of linkage disequilibrium at the CD4 locus and modern human origins. Science 271: 1380-1387.
  21. Fischman, J. 1996. Evidence mounts for our African origins - and alternatives. Science 271: 1364.
  22. G. and B. Rannala. 1998. Using rare mutations to estimate population divergence times: A maximum likelihood approach. Proceedings of the National Academy of Science USA 95: 15452-15457.
  23. Seidler H, Falk D, Stringer C, Wilfing H, Muller GB, zur Nedden D, Weber GW, Reicheis W, and Arsuaga JL. 1997. A comparative study of stereolithographically modeled skulls of Petralona and Broken Hill: implications for future studies of middle Pleistocene hominid evolution. J. Hum. Evol. 33:691-703.
  24. Schwartz, J.A. and I. Tattersall. 1996. Significance of some previously unaccompanied apomorphies in the nasal region of Homo neandertalensis. Proceedings of the National Academy of Science USA 93: 10852-10854.
  25. Laitman, J.T.,  J.S. Reidenberg, S. Marquez, and P. J. Gannon. 1996. What the nose knows: New understandings of Neanderthal upper respiratory tract specializations. Proceedings of the National Academy of Science USA 93: 10543-10545.
  26. Clarke, T. 2001. Relics: Early modern humans won hand over fist. Nature.
    Niewoehner, W. A. 2001. Behavioral inferences from the Skhul/Qafzeh early modern human hand remains. Proceedings of the National Academy of Sciences.
  27. Holden, C. 1999. A New Look Into Neandertals' Noses. Science 285: 31-33.
  28. Krings, M., A. Stone, R. W. Schmitz, H. Krainitzki, M. Stoneking, and S. Paabo. 1997. Neandertal DNA Sequences and the Origin of Modern Humans. Cell 90: 19-30.
  29. Igor V. Ovchinnikov, I.V., A. Gotherstrom, G. P. Romanovak, V. M. Kharitonov, K. Liden, and W. Goodwin. 2000. Molecular analysis of Neanderthal DNA from the northern Caucasus. Nature 404: 490-493.
  30. Krings, M., C. Capelli, F. Tschentscher, H. Geisert, S. Meyer, A. von Haeseler, K. Grossschmidt, G. Possnert, M. Paunovic, and S. P��bo. 2000. A view of Neandertal genetic diversity Nature Genetics 26: 144-146.
  31. Arnason, U., X. Xu, and A.Gullberg. 1996. Comparison between the complete mitochondrial DNA sequences of Homo and the common chimpanzee based on nonchimeric sequences. J. Mol. Evol. 42: 145-52.
  32. Stringer, C. B. and R. Mackie. 1996. African Exodus: the Origin of Modern Humanity. Cape, London.
  33. Adcock, G.J., E.S. Dennis, S. Easteal, G.A. Huttley, L.S. Jermiin, W.J. Peacock, and A. Thorne. 2001. Mitochondrial DNA sequences in ancient Australians: Implications for modern human origins. Proceedings of the National Academy of Science USA 98: 537-542
  34. Foley R. 1998. The context of human genetic evolution. Genome Res 8:339-347.
  35. Klein, R.G. 1992. Evolutionary Anthropology 1: 5-14.
    Balter, M. 1999. Restorers reveal 28,000-year-old artworks. Science 283: 1835.
  36. Simon, C. 1981. Stone-age sanctuary, oldest known shrine, discovered in Spain. Science News 120: 357.
  37. Bower, B. 1986. When the human spirit soared. Science News 130: 378-379.
  38. Clark, G.A. 1999. Highly visible, curiously intangible. Science 283: 2029-2032.

Note:
The 50,000 year date is the best estimate for modern human origins because the study used a much larger nucleotide base pair sample size, resulting in a much less uncertainty in the date generated (see the table below for further explanation).

  95% confidence interval  
Study Model # base pairs # men Total base pairs Lower Upper Mean Male population size
Dorit, et al. Coalescent 729 38 27702 0 800,000 270,000 7,500
Dorit, et al. Star phylogeny 729 38 27702 0 80,000 27,000 7,500
Hammer Coalescent 2,600 15 39,000 51,000 411,000 188,000 5,000
Whitfield, et al. Coalescent 18,300 5 91,500 37,000 49,000 43,000 not given
The estimate of modern origins is highly dependent upon the assumed population size (last column of table). The first study assumed a male population size of 7,500 individuals for the entire period of humanity (excluding the last couple thousand years, of course). Such a population size, according to the authors, is "an exceedingly small population size for this entire 300,000 year period" (16). However, such as small population size was necessary to make the coalescence time as large as it was. Hammer used an even smaller population size (5,000), since he was concerned that his study would not be accepted if the coalescence time was too small (which he admitted to doing in Internet dialogs). The first two studies (Dorit, et al. and Hammer) have very large confidence intervals, due to the small number of nucleotide base pairs analyzed. Given the size of the confidence intervals in the first two studies, the numbers from all three studies are basically the same. Obviously, the Whitfield, et al. gives the most precise estimate of the date for the appearance of modern humans.

Home | Apologetics | Answers | Love | Slideshow | Evolution/Design | Discussion
Personal | Webmaster | General | Doctrine | Cults | Discovery | Young-Earth | Search

Last updated 08/02/01

Hosted by www.Geocities.ws

1