LIVING ENVIRONMENT II


Welcome students to Living Environment II. This course is a continuation of Living Environment I. At the end of this course, you will be required to take the Living Environment Regents in June 2006.


I hope you have a wonderful and successful semester.


Fertilization and Development:

Fertilization is the process whereby a sperm from the father penetrates and exchanges its genetic information with an egg from the female. Please note that sex cells are also called Haploid cells and regular body cells are called Diploid cells. For example: The human cell contains 46 chromosomes. The 46 chromosomes is referred to as the Diploid number. For sex cells or gametes, sperm or egg, the chromosome number is cut in half. Because of this, sex cells are referred to as Haploid cells. So when two Haploid cells combine as in the case of fertilization, you will get the Diploid number of chromosomes back. For example when a sperm meets and penetrates an egg, the normal chromosome number is restored. The resulting fertilized egg cell is then called a Zygote. Fertilization occurs in the Fallopian tubes of the Female. Once the egg is fertilized, it begins its journey towards the Uterus where the Embryo will attach itself and start to Develop. Before the Zygote reaches the Uterus, it undergoes a series of cell divisions called Cleavage. These rapid divisions occur by Mitosis. As a result of Mitosis, all the genetic information in all the new cells that are made is Identical. Recall: (In Meiosis, this does not occur. Instead, you have half of the genetic Information in all the newly formed cells. These cells are also going to be sex cells or gametes.) As the cells are dividing rapidly in the Zygote, it forms a hollow ball structure called a Blastula. The Blastula has a single layer that looks like a bracelet or necklace. After the Blastula stage, the zygote then starts to have some protrusions or layers. This stage where the zygote makes layers is called gastrulation. There are three layers that are formed. They are called Ectoderm, Endoderm and the Mesoderm. By this point the zygote makes its journey to the Uterus where it implants itself where it will grow and develop further. The developing embryo gets all its nutrients and release all its waste products by the Placenta.

Types of Fertilization:

Fertilization can occur inside of the Female or on the outside of the Female. When fertilization occurs on the inside of the female it is called Internal fertilization. An example would be humans and dogs, where the sperm of the male meets and penetrates the egg of the female on the Inside of the Female. When the sperm and the egg meet on the outside, it is called External Fertilization. An example would be frogs and fishes, where the male releases sperm as the female lays the eggs on the outside.

Types of Development:

Once the egg is fertilized, the next step is development. Humans develop internally or on the inside of the Female. The developing Embryo gets its nutrients from the Placenta. In cases like fishes, birds and frogs, development of the embryo occurs on the outside or External. When an organism develops externally, it usually gets nutrients from the Yolk sack that is inside of the egg. For example: before a chicken comes out of the egg, it feeds on the yellow yolk for approximately 3 weeks before it is hatched.

DNA and DNA Structure:

The next Topic we will look at is DNA. As you might have learned already, DNA is the genetic material that gets transferred from every dividing cell. In actuality, DNA is what makes up a person or animal. DNA carries all the traits determining how a particular organism is going to grow, look, and carry out other life functions. DNA is found in the nucleus of all Eucaryotic cells such as animals, plants and humans. Prokaryotic cells do not have a nucleus so their DNA is scattered inside of the Cytoplasm. When the cell divides, the DNA must also divide so that each new daughter cell can receive the same amount of DNA as the original parent. For example, if I has 5 dollars, would it be possible to give two students 5 dollars each? No way!!! I would have to double or replicate that 5 dollars, before I can give two students that same amount. Now you know why a cell MUST replicate its DNA before dividing. It has to be able to give each daughter cell the same amount of DNA.

DNA STRUCTURE:

The structure of DNA takes on a double helix orientation. It looks like a zipper that has been twisted and curled inside out. Well, a molecule of DNA is double stranded. That means it has two molecules that are lined up side by side. DNA is made up of three units: These units are Nucleotides, a Phosphate group and a sugar called Deoxyribose. There are 4 nucleotides or Bases. These are called Adenine, Thymine, Guanine and Cytosine. The way these Nucleotides pair up is also very specific. The way they pair up is called complementary base pairing. Thymine (T) is always bonded to Adenine (A). Guanine (G) is always bonded to Cytosine (C). So, a molecule of DNA is consisted of many, many, many pairings of (A-T), (T-A) and (G-C), (C-G). The DNA molecule is held together by Hydrogen bonds that are formed between these Complementary pairs.

DNA REPLICATION:

As we mentioned, all cells MUST replicate its Genetic Information before the cell can divide. DNA replication occurs just before the cell divides during the S phase of the cell cycle. Before the DNA can replicate, the double stranded helical structure MUST first start to separate or unzip. DNA polymerase is the enzyme that is needed for DNA replication to occur. Once the two strands are separated slightly, DNA Polymerase add new Nucleotides to the Original strand. Of course, these Nucleotides MUST be Complementary to the Old strand. DNA Polymerase also corrects any bases that have been incorrectly paired with one another. Once all the bases have been added to the two old strands, you would end up with 2 sets of double stranded DNA molecules that are the exact replica of the Original strand. Once this is over, then the cell can divide and pass on the exact amount of DNA to its daughter cells.

Chromosomes and Genes:

Well so far we have learned that DNA, the genetic information stored in the nucleus of most cells is carried from generation to generation via Mitosis and Meiosis. DNA seems to always be alive, and as long as an organism continues to reproduce, its DNA will continue to survive. The next step in learning about DNA and the genetics that comes from it is what we will call GENES. Recall, we said that all DNA has to be nicely packaged and Replicated before the cell can divide. Well, this packaged form of the DNA is called Chromosomes. You should NOT think of it in any other way other than the fact that it is Packaged DNA. Before the cell divides, the DNA is scattered inside of the nucleus in most cells. Once the cell decides to divide, it has to organize and package the DNA into Chromosomes. Every organism has a Specific Number of chromosomes. For example, humans have 46 Chromosomes and the fly has 8. No two organisms will have the same number. Once the chromosomes are ready, they are then distributed to each of the daughter cells during Mitosis and Meiosis. Inside the chromosomes are what we call Genes. Genes are all the hereditary information that will ultimately determine how you will look and function. Genes can come in two or more forms called alleles. For example, your eye color is a gene located somewhere on one of your chromosome. However, there are all different types of eye colors. We have brown, black, green, blue and even gray. All these different forms of eye color are referred to as alleles. That means that although the gene is eye color, you have different forms or alleles of that same gene. The same thing would go for hair color, skin color etc. Genes are located by themselves or with other Genes. When a gene is located by itself and it produces a specific trait or characteristic, it is referred to as a single gene. For example, the hair line in the middle of your hair is controlled by only ONE gene. So people would either have this hairline or would NOT. On the other hand, if the Gene is located with other genes on the Chromosome, they might be working together to produce a particular trait or characteristic. We call these types of genes Polygene or multiple genes. So if you have a trait that is Polygenic, it means that you might have several alleles (genes) for that Trait. Height is a polygenic trait which results in different height ranges among several people. As we will talk about next week, genes are also Dominant and Recessive.

Chromosome Distribution during Meiosis:

As we mentioned earlier, during Mitosis the daughter cells receive the same sets of Chromosomes or DNA from the parent cell. Well, during Meiosis a series of changes can occur among the Chromosomes while they are being distributed to the new daughter cells. Recall that Meiosis has two rounds called Meiosis I and Meiosis II. During Meiosis I, chromosomes tend to twist around and break off from each other and reconnect with their neighbors. This breaking and reconnecting business that occurs with chromosomes is called Crossing over. This allows genes on these chromosomes to be mixed up or exchanged as they are being distributed. Let me explain this a bit more using this technique. Pay close attention Guys!!! Suppose you have a chromosome that contains the genes A-B-C-D-E-F-G-H. Notice that this particular chromosome contains 8 genes. Now within that same cell, you have another chromosome that contains these genes 1-2-3-4-5-6-7-8. Notice that as above, this particular chromosome also has 8 genes on it. During Meiosis I, these two chromosomes above will break off from their partners and reconnect with the other chromosome giving you this NEW VARIATION: A-B-C-D-1-2-3-4 and E-F-G-H-5-6-7-8. So now with Crossing over occurring, you have a variation or difference in what was considered the old chromosome. Now you have 2 new chromosomes that have different genes than before. This is why in sexual reproducing organisms you have that VARIATION. Now when the cell divides the new daughter cells will be different from the parent cell. I hope you guys get this!! Then the cell will go on to Meiosis II, which allows these 2 daughter cells to reduce their genetic Information or Chromosome number by HALF. Reducing its DNA or Chromosome number by half is also called Chromosomal Reduction. That is Meiosis I and II in a nut shell.

Chromosome Alterations:

When a cell divides during Meiosis, the distribution of Chromosomes is sometimes NOT always perfect. This unequal distribution of the Chromosomes causes some changes that are sometimes deadly for the organism. For example: A deletion is a type of alteration where a piece of chromosome breaks off and does not rejoin with the other homologous chromosome. Therefore the cell will go on to divide and one of the daughter cells that are produced will end up with a shortage of genetic material. This is NOT good for the organism. Another example is addition, where you have a piece of chromosome breaking off and just adding on to another chromosome. Again the cell will go on to divide producing 2 daughter cells, BUT one will have more genetic information than the other. This is also bad news for that organism. There are a few more that rarely occurs, but keep in mind that they when they do occur, it is BAD news for that organism. Another example of how chromosomes may be altered during cell division is Polyploidy. In this case, meiosis fails to produce a daughter cell that is Haploid (n). Instead, the daughter sex cell is diploid (2n). This is very strange but it does happen on occasions. Now, what do you think will happen if you have sex cells or gametes that are diploid instead of being haploid? Well just suppose a normal Haploid sperm meets an egg that was Diploid. The resulting embryo will be Diploid, Haploid or Polyploidy? The answer is Polyploidy or in this case n+2n=3n. This 3n organism is not normal and will have serious complications. It might even die before it can be born. The last alteration that can occur during Meiosis is called Nondisjunction. This occurs when a set of chromosome fails to be distributed equally during Meiosis I. After Meiosis I, you will end up with 2 daughter cells as usual, BUT one will have an extra set of chromosome and the other will be missing a set. NOW during Meiosis II, which will eventually produce 4 daughter cells (sex cells) that contains half (haploid) of the genetic information as the parent cell, there will be problems. What will happen is this: You will end up with your normal 4 sex cells at the end of Meiosis I and II, BUT 2 of those sex cells will be missing an entire chromosome and the other 2 will have an extra set. So if a normal human sperm cell (23) meets an egg cell that contains an extra chromosome (24), then when the egg is fertilized, the resulting zygote will contain a total chromosome number of 47. This is what happens in the case of Down.s Syndrome. People with this genetic disorder have a total chromosome number of 47 instead of the normal number of 46.

RNA and Protein Synthesis

Just like DNA, RNA (Ribonucleic Acid) is a molecule made up nitrogenous bases. However, there are a few differences that you should be aware of. Lets first go over these differences and then we will talk about the function of RNA. RNA is a single stranded molecule that is made up of the same components as DNA. These components are the nitrogenous bases, the sugar group and the Phosphate group. However, in RNA the bases are A, U, C and G. Please take note the in the RNA molecule, U (uracil) replaces the T (thymine) that is found in DNA. That means wherever you see a T in a DNA molecule, you will have to replace the T with a U in the RNA Transcript (mRNA). Another difference is Location. The DNA as we know can be found in the nucleus of most cells. DNA cannot leave the vicinity of the nucleus. RNA however can be found in BOTH the nucleus and the cytoplasm. So to sum up the differences between the two we can put them into categories of Structure.single strand or double strand, Location.nucleus or cytoplasm or BOTH, Bases.RNA has Uracil in place of Thymine, and also RNA has Ribose whereas DNA has Deoxyribose.

RNA Function: The function of RNA.

There are 3 types of RNA and they all have specific functions. Messenger RNA is made when RNA Polymerase copies the complementary bases from one strand of DNA in the nucleus during a process called Transcription. This messenger RNA (mRNA) then carries the genetic sequences from DNA out of the nucleus and into the Cytoplasm where the Ribosomes are. So the function of mRNA is to transport the genetic sequences from DNA to the ribosomes in order to make the proteins. Transfer RNA brings the amino acids to the ribosomes so that it can base pair or bind to the mRNA sequences. Remember that sequences can only bind to each other when they are COMPLEMENTARY. That means if an mRNA has a codon that reads AUG, then the transfer RNA (tRNA) must bring in an amino acid that carries the codon UAC. I hope you get this!!! The process where a transfer RNA binds to the complementary sequence on mRNA to make an amino acid or protein is called Translation. The other RNA is called Ribosomal RNA (rRNA). These are the RNA that make up the ribosomes. So, as you can see, each one of these RNAs have specific functions inside the cell.

DNA-.RNA-.Protein Synthesis:

All along we have been talking about DNA, chromosomes, genes, traits, RNA and Proteins. Now lets try to put all this information together so it can make more sense. Well, we already know that before a cell can divide it MUST replicate and package its DNA into Chromosomes. The genes that determines how an organism will look and function are packed inside the chromosomes. However, how will the cell know which protein to make and when to make it. Well, that.s where RNA comes in. Since DNA cannot leave the nucleus of the cell, the information MUST be sent to the ribosomes somehow. Well that.s why we have messenger RNA. Recall that mRNA is made in the nucleus and then it can also leave the nucleus and enter the cytoplasm of the cell. Well, when it leaves the cell, it is leaving with all the information it has just copied from the DNA. This is a good way for DNA to PIGGY BACK the information from inside the nucleus to the ribosomes. The mRNA now takes the information that the DNA wants the cell to do and bring it to the ribosomes where the protein for the specific task is made. Those of you who still did not get it can also look at this in another way. Imagine that you are the President of the US. You are on vacation on an island somewhere in the Pacific. You do NOT have any transportation around you and you would like to eat some Pizza. There.s no way you can leave the island because you are surrounded by water. What will you do????? Well, lucky for you, you have your lap top and you are now going to send a message using e-mail to the NAVY telling them to drop off a pizza for you on the island. Notice that you will get exactly what you want (pizza with extra cheese, pepperoni, pineapples and mushrooms) without leaving the island. This is exactly how DNA and RNA work to make the necessary PROTEINS for the cell. I hope you get it now!!

Breakdown: DNA to RNA is called Transcription and it occurs in the nucleus of the cell. RNA to PROTEINS is called Translation and it occurs in the cytoplasm of the cell, in the ribosomes.

Genes, Dominance and Recessive:

We will now focus on a new branch of study called genetics. So far we have been learning about DNA-> RNA-> PROTEIN SYNTHESIS. Well now its time to look at how Genes and Traits are related and how do we get them. As we already know, we get all of our characteristics (traits) from our parents. For the next 2 weeks we will be studying how these characteristics are inherited from one generation to the next. The study of how genes get transmitted from one generation to the other is called Genetics. As you probably figured out by now, Genetics deals with the inheritance and probabilities of GENES. As we mentioned before, genes are located in the chromosomes. Recall the famous ideology:

Cells-Nucleus-DNA-Chromosomes-GENES-mRNA-Proteins

Genes are those important pieces of DNA sequences that codes for all the characteristics that makes you up. Genes come in all forms. For example, you have genes for eye color, height, weight, skin color etc. Different forms of a gene are called Alleles. So for the gene responsible for eye color, you would have a number of alleles such as brown eyes, blue, hazel, brown etc. Genes are also Dominant and Recessive. For example, lets say your mother has blue eyes and your father has green eyes. What color eyes do you think might be more common or Dominant in your brothers and sisters. Well, if all your brother and sisters have blue eyes, then you can be sure that Blue is Dominant over Green eyes. You can think of Dominance as being stronger and more powerful than recessive. Genes are always represented using Letters. For example, since we already decided that Blue eyes are Dominant over Green eyes, we can assign the gene for Blue eyes as BB or Bb. BB means that you have both Dominant alleles for that gene. One B came from your mother and the other B came from your father during fertilization. Recall that Fertilization is really Haploid + Haploid = Diploid. So when one B from the sperm was added to the other B from the egg you end up with BB. In the other case Bb, the big B means that one of your parents had it. The other small b meant that your other parent has it. So when Fertilization occurred, you ended up with Bb. Now, please be aware that although you have a small b in the Bb diploid, this still means that you are dominant over the recessive green eyes. That means that a person who is Bb can still have blue eyes because it only takes one big B to have blue eyes. In the Recessive case, the genes are given this type of lettering bb. Small bb really means that both your parent had small b + small b when their sperm and egg met for fertilization, giving you bb. This means that you will always end up with green eyes. Now when you grow up and start producing sex cells, your genes or alleles will also tend to separate when Meiosis occurs. So if you are a person that is BB, when you produce you sex cells, you will produce 4 sperm cells (if you are male) with each sperm having ONE B. If you are a female you will produce an egg cell that will also have one B. If you are Bb, you will have 2 sperm cells with B each and the other 2 will be small b. If you are bb, you will have all sperm cells having ONE small b. This is the Law of Segregation, which states that all genes/alleles are separated during Meiosis. This Law states that if you have 2 alleles for a specific gene, during Meiosis all the gametes that are made will ONLY have one copy of that gene.

Gregor Mendel:

Mendel was a famous geneticist who worked on pea plants to see how genes were separated or segregated during meiosis. He was able to use the Punnet Square to determine the genotypes of the offspring that were made when 2 plants were mated. Genotypes are the actual genetic make up of an organism. It is always represented using the lettering format mentioned above. So an organism that has a gene for eye color can have any one of the following genotypes: BB, Bb, or bb. There are no other combinations to represent this Gene. The way an organism looks is called the Phenotype. For example, in most of his experiment, Mendel was able to tell which of his plants were Tall and which ones were short. So Tallness and Shortness are examples of Phenotypes. If one of his plants had a Genotype of TT, Mendel was able to tell that this plant was Tall. Because it had 2 copies of the same gene T and T, it was called a Homozygous Dominant pea plant. Some of his other plants had a Genotype of Tt. This meant that although it had one Dominant copy T, and one Recessive copy t, he called this pea plant a Heterozygous plant, simply because it has one big T and one small t. The plants that had Genotypes tt, were called Homozygous as well, BUT because they were the small t, they were called Homozygous Recessive.

Punnet Square and Test Crosses:

In order to show his Genotypes when he mated his plants, Mendel used the Punnet Square to show the possible ratios of Gene distribution in the offspring. In one of his crosses he mated a Tall plant with a short plant to see which one out of the two genes (Tall or short) was Dominant. The Tall plant had a Genotype of TT or Tt. The short plant had a Genetype of tt. The plant that was TT would produce gametes that will have one copy of the T gene. The plant that was Tt would have gametes that will have one copy of the T gene and others will have one copy of the t gene. The plant that was tt, will have one copy of t in all its gametes. When fertilization occurred, you would have gotten the following:

TT mated with tt gives you 4 offspring with Genotypes Tt. The ratio here is 100% all Tall.

Tt mated with tt gives you 4 offspring with Genotypes Tt, Tt, tt, and tt. The ratio here is 50% Tall and 50% short.

From these results, Mendel was able to say that the Tall gene was Dominant over the Short Recessive gene. He was right because in the Testcross TT mated with tt, all the offspring were Tall. That's how he knew that T was Dominant and t was recessive.

Genetic Engineering:

Now that we have a pretty good idea of what Genetics is, now its time to look closer on how Scientist can use this type of knowledge to do better things. The way in which Scientists use Technology to enhance techniques in Genetics is called Bio-Technology. The art of Manipulating genes (pieces of DNA) so that a bigger and better product or organism can be made is called Genetic Engineering. The term speaks for itself if you really look at it. Genes comes from Genetics and constructing or building comes from Engineering. This field of science is very demanding and it changes every so often as really cool techniques for doing really cool things come up. The first Techniques that allowed Humans to become well advanced in the field of creating desired organisms is called Selective Breeding. Selective Breeding allow us to put all the good traits (GENES) of a particular organism or organisms together, creating one organism that can do it all. For example, in the St. Bernard dog bloodline, the traits for saving people in times of crisis have been carefully selected and passed on from one generation to the next. This dog is now considered the smartest and strongest dog in Europe. In other words, selective breeding experiments allowed Humans to create a new breed of dog that has been bred for a sole purpose. For St. Bernards, the sole purpose is rescue. Other dogs such as Golden Retrievers and Labradors were selectively bred for helping people with disabilities go places and do things they thought they could never do on their own. Can you come up with a Perfect dog for a specific purpose? Once these types of breeds are made, the only thing left to do is to reproduce them, so that the rest of the world can enjoy the benefits of these dogs. The process where these traits are maintained from generation to generation through breeding is called Inbreeding. Inbreeding a specific set of traits can promise that only those traits will be displayed in all the offspring. So once a new Breed of dog has been created, that particular breed will never go extinct as long as people keep breeding them. There is a disadvantage to this Inbreeding process however. Since Inbreeding is really a nice way of saying "sticking to your own kind", this can be dangerous if a particular gene is Mutated. There is also NOT too much room for Variation among the other dog species. If you have a mutation in a gene or you have a gene that carries a genetic disease, breeding two dogs can only increase the chances of having sick or diseased offspring. Other than this, selective breeding has proven to be very effective and worthy for both plants and animals.

Genetic Transformation:

Transformation is a process where a cell takes in DNA from another organism and incorporates that new DNA into its own Genetic Information. That means that the external or foreign DNA becomes part of the organisms DNA. Transforming bacteria has played an important role in science. For example, scientists can now insert the Human gene for Insulin production into a bacteria's DNA using a plasmid. A plasmid is simply just a circular piece of DNA that can be found in bacterial cells. Scientists can cut a segment of this plasmid and replace it with whatever gene they would like to see expressed in the bacteria. So if you wanted to make Human Insulin, all you would have to do is insert the Human Insulin gene into the plasmid and then reinsert the plasmid into the bacteria. The newly combined DNA also called Recombinant DNA will mix in with the bacteria's DNA and express the Human Insulin gene. In other words, the bacteria will now make Human Insulin. This was a major benefit for Diabetic patients who needed Insulin to regulate their blood sugar levels. Now Insulin can be affordable and plentiful due to bacterial Transformation. Other such Transformations occur in plants and other animals as well. You may want to see your Textbook for these examples.

Cloning:

Cloning is the process of reproducing cells that are genetically identical to the parent cells. Scientists have been able to make clones using animals and plants alike. The sheep named "Dolly" was made via a Cloning technique that allowed us to see how powerful this tool can be. Dolly looked nothing like her mother simply because Dolly had no genetic information from her mother. Dolly's DNA was taken from another sheep and reinserted into the egg cell of Dolly's mother. Therefore Dolly is genetically identical to the other sheep from which the DNA was taken from. By using this tool, scientists could make clones of animals and plants without the need for males to fertilize and impregnate females. You must be aware of the ethical and personal issues behind cloning Humans. Our government has placed a strong ban on the cloning of Humans in the United States. This issue as you can imagine brings controversy due to religious and other reasons. Cloning is a form of asexual reproduction because there is no fusion of sex cells or gametes. Also the offspring that are produced are genetically identical to the parents. Only one parent is needed and there is no fertilization involved.

Genetic Variation:

As we learned before, mutations are random genetic changes that occur in nature. Mutations can be good and they can also be very bad. For example, let's say someone was exposed to a radioactive material such as plutonium. This material will probably cause some type of structural changes in that person's DNA. This alteration in the structure or sequences (A,T,C,G) of the genes can have devastating consequences. Females who have been exposed to radiation while they are pregnant can give birth to deformed children. Recall that in order for a Mutation to pass on to the next generation, that mutation must occur in the sex cells of that organism. If a mutation occurs in a regular body cell like your heart cell or lung cell, only you will be affected. No future generation will be affected by that mutation because lung and heart cells are not sex cells. Mutations can also occur to produce an entire different phenotype in some organisms. For example, suppose you have a mutation in a gene for eye color. Instead of producing blue eyes, you might now end up producing green eyes as a result of that mutation. Here is where mutations can add genetic variability in a species. When mutations produces a functional and normal offspring with just some slight modifications in the way the organism looks, that mutation is said to be of benefit to a species. As you can see, now you would have two types of colors instead of just one. Humans sometimes induce mutations onto plants and animals in order to see the difference in phenotype when compared to the normal population. They do this sometimes to encourage or increase the genetic variability of the genes among a species. They use radiation, chemicals and other sources of tools to induce mutations. Keep in mind that sometimes these chemicals and other sources can cause cancer in these plants and animals.

Manipulating DNA:

DNA manipulation is a genetic technique that allows scientists to make changes in DNA sequences so that they can see the consequences and then make adjustments for those changes. This field of genetics is becoming important in finding cures and other ways of treating genetic diseases like cancer and heart attacks. Before scientists can make changes to DNA they must first be able to remove the DNA from cells. This process where DNA is removed and separated from the other parts of the cell is called DNA Extraction. Once they have removed the DNA from the cell, they must now cut up the DNA using Restriction enzymes. Restriction enzymes cut the DNA at specific places that the scientist want to cut them at. For example if you have a piece of DNA that reads ATCCGTATTACTGCCCTATTCTA, and you want to cut this strand of DNA at a region where you have the sequences TATT. You will have to expose this DNA to a Restriction enzyme that would cut at exactly TATT. Therefore you would have 5 pieces of DNA when you are done. You would have ATCCG, TATT, ACTGCCC, TATT and CTA. Once your DNA is all cut up, you now have to separate the DNA. You can separate DNA by two ways: By size and then by their electrical charges (positive or negative). A gel is used to separate DNA by size and by charge. This separation and analysis is done using a process called Gel Electrophoresis. By using this Gel, you can be able to see where on the Gel the DNA is located. You can also use this technique to see how similar a piece of DNA might be between 2 people. Recall the DNA Fingerprinting Lab, where a person had to find his parents by comparing his DNA to the DNA of 10 other people using this technique.

Evolution:

We will now take a different step towards our next topic called Evolution. Please be aware that genetics will always play a role in Evolution so keep in mind the genetic concepts that you guys learned about previously. Evolution is a gradual change in a species over a period of time. According to Charles Darwin, also called the father of Evolution, he believed that organisms will be forced to evolve when there is a change in the environment. His famous theory "survival of the fittest:, was proposed when he did a study on the Galapagos Islands using Finches. Darwin believed that certain finches had to evolve a certain beak size in order to utilize particular seeds that were grown on the island. If the finches did not evolve this beak size, they might not be able to break open the seeds and would eventually die off. Well, according to Darwin's theory of Natural Selection, only the birds (Finches) that are BEST suited for the changing environment will be the ones who will survive and reproduce. By doing so, it was almost guaranteed that those genes needed for survival would be scattered in the population. All the other birds that did not possess those genes for beak size would be forced into extinction through death by starvation. Natural selection according to Darwin was really "survival of the fittest". This meant that only those individuals that possessed those genes needed for survival in a particular environment will be the ones to survive. All others would perish. Darwin also proposed that organisms displayed great diversity depending on the environment they live in. Therefore it can be hypothesized that the way an organism looks, behaves and reproduce is directly dependent on the environment in which it lives. For example, polar bears in the north pole are white in color and have thick fur to prevent them from freezing. These characteristics allow the polar bear to camouflage itself while hunting for its prey. A Grizzly bear on the other hand which is brown in color and have relatively thin fur would not be able to survive in the North Pole. I hope you can see why. So, as a general rule, Evolution will continuously occur as long as the environment allows it. Organisms will continue to master the art in living in their environment as it changes.

Factors that drive Evolution:

There must be some factors or forces that drive the Evolutionary race among different species on this planet. As we mentioned above, it seems clear that the Environment is a major contributor to evolution. Factors such as climate, weather and availability of food source are all Environmental factor that somehow shape the way in which organisms must evolve to adapt to their environment. Recall that Adaptation is the ability for an organism to adjust and live in a changing environment. The ones that are best adapted are the ones that will go on to reproduce and populate the land. Another factor is Mutations and Genetic variation. As we previously learned that genetic variation is what accounts for the survival of a species. The organisms that are most genetic variation will be the ones that will adapt to the environment and survive. Geographic changes in nature can also create a door for evolution. Volcanoes and earthquakes can often at times separate islands and other land areas causing a species to become Isolated from each other. Due to differences in climate and food sources available, a certain species might be forced to evolve causing them to become a totally new species. When a new species is created from an ancestral species due to geographic isolation, it is called Speciation. Natural Selection also drives the evolution of species. Organisms will soon realize that they must adapt to changes in order to survive and only those who adapt will be able to reproduce and spread their genes to the next generation. As we will learn later on, Human impact on the environment also drives the evolution of species in an environment.

Evidence of Evolution:

It is always good to provide some type of evidence when talking about evolution. As you all know, evolution has its controversies much as cloning. Personal beliefs on the subject can create problems between various groups of people. As for our sake, we will now try to put down some evidence of this great phenomenon. The first evidence of evolution was provided on the basis of fossils. Old bones, rocks and soil and other archeological findings presented data which led us to believe that animals were once in contact with each other before the world separated. Another much more credible finding was the Homology in body parts of various organisms. For example, the wings of birds, the hands of humans and the flaps of a whale all have some similar identity regardless of different function. This suggests that all such organisms must have some type of common ancestral origin. At least if you were to observe the bone structures of these homologous body parts, it can be quite clear that they all have some type of resemblance. The other evidence was more convincing. Organisms seem to have embryonic developmental similarities during the early stages of development. A baby bird and a baby human and also a baby rat all have the same shape and morphology during early development. This evidence also suggested that these organisms derived from a common ancestor millions of years ago. From an evolutionary point of view, it can be amazing to learn that humans and chimpanzees are 98% similar in every way. There.s a final thought for you to consider. We will look at Cladograms to determine how various species are related and from which ancestor did they descend from next week.

Phylogenetic Trees (Cladograms):

In order to determine the age andrelationship between various species, scientists have used a diagram called the Cladogram. Also called a Phylogenetic Tree, this diagram also provides Evolutionists with information regarding speciation and extinction of species. Recall that speciation is when one species become 2 or more new species due to a drastic change or isolation in an environment. Geographic Isolation and reproductive isolation are 2 factors that bring about speciation. Phylogenetic Trees also shows you the common ancestor from which all existing species descended from. As you saw in the documentary .Evolution., man and chimpanzees are closely related on the phylogenetic tree. As a matter of fact, man is 98% related to the chimpanzee. Phylogenetic Trees also provide us with a timeline so we can see at what time (millions of years) a particular species lived for before they went extinct. A Phylogenetic Tree is very much like a family tree, where you see how far back you can trace members of your family.

Ecology:

As a step beyond Evolution, we will now turn to our next Topic in Ecology. Ecology as you might have previously learned, deals with the study of all living things in our environment. How a lion chases and catches a zebra and the germination of a seed to a tall tree in the Amazon all relates to Ecology some way or the other. As the world exist, we are all aware of the different climate and weather patterns in other countries. We also know that where there.s a different environment, you will also have different and distinct living things in that area. Well, the world believe it or not has many diverse environments each containing various and totally adaptable organisms. The study of how all the living and non-living things in an environment interact and live with each other is called an Ecosystem. As we soon learn, the world contains many different types of Ecosystems based on the climate and weather conditions in those areas. We will see how polar bears and grizzly bears both inhabit different environments despite their Evolutionary relationship or common ancestry.

Flow of Energy:

When we eat pizza or a sandwich for lunch we are just doing what MUST be done in order to survive. As we learned previously, we need food so that we can get all the ENERGY that our body requires for all life functions.Metabolism. Well, the question asks, if we eat a sandwich that contains 200 calories, do we end up with that same number of calories at the end of the day. Of course the answer is NO!! That is because we use up some of these calories for our everyday activities such as walking, breathing, singing and dancing and doing homework. Just that you are aware, whenever we eat anything, we will always be using ENERGY for everything that we do. In real life Ecosystems, when a rabbit eats the leaves of a plant, the rabbit can only get so much energy from those leaves. Although the energy is TRANSFERRED from the plant to the rabbit, the rabbit never gets to keep ALL the energy that it got from the plant. The rabbit must use up some energy for hopping around and doing its daily activities. Unfortunately, sooner or later the rabbit will get eaten by a fox or a lion and then that ENERGY that was stored in the rabbit will now be transferred to the lion or the fox and so forth. So as we can see, ENERGY is never lost or destroyed. It just gets used up somewhere and then transferred to other organisms. Well, to illustrate this transfer of Energy much better, Ecologists have placed this energy transfer from one organism to the other in a diagram called the Energy Pyramid. An Energy Pyramid shows the direction and flow of Energy in an Ecosystem. At the bottom of the Pyramid (A) are the plants and algae. They are called Producers because they produce all the INITIAL energy for the restr of the organisms in the Food Chain. A Food Chain is a drawing that shows the transfer of energy in an ecosystem. We will come back to this later. The plants and algae get their energy from the sun in a process called Photosynthesis. Once they make their food, the plants provide this energy to organisms such as rabbits and grasshoppers. When the rabbits eat the plants, they get energy and then transfer SOME of this energy to lions and foxes when they get eaten. At some time the lion might get eaten by a Hyena and then SOME of that energy will be transferred to the Hyena and so forth. So as you go up the Pyramid, the amount of available energy that is available at the next Trophic level is reduced greatly. The organisms that are at the top of the Pyramid hardly get any energy by the time they get their meal. Please refer to your drawing of the Energy Pyramid for this section.

Please be aware that the organisms that are at the bottom of the Pyramid will always be Plants and Algae. Plants and algae are called producers because they are the ones that produce the INITIAl energy for the other organisms. They are also called Autotrophs because they can make their own food using energy from the sun. Because they are at the bottom of the Pyramid, they also contain the MOST available energy all the time. The next level of the Pyramid contains organisms like rabbits and grasshoppers etc. These organisms are called Primary Consumers or Herbivores. Herbivores are organisms that feed on Producers ONLY. These organisms will be found in level "B" in the Pyramid above. Some of the energy that they get from the plant will eventually be used up and the rest will be transferred to the lions or any other organism that eats them. Organisms at the next level such as lions and foxes are called Secondary Consumers or Carnivores. These Secondary Consumers eat ONLY Primary Consumers. They will be located in level "C" in the Pyramid shown at the top. Organisms that are at the top can be humans or any other large animal that can eat practically any thing shown in the Pyramid. These organisms at the top are usually called Tertiary Consumers or Omnivores. Although they receive very little amounts of energy from level "C" organisms, level "D" consumers have to be able to eat other animals to survive. The energy they get from level "C" consumers is JUST NOT ENOUGH.

Ecosystem:

We have already determined that an Ecosystem is an interaction between the living and non-living things in an Environment. Well, although these living and non-living things interact with each other, there.s always some problems involving the relationships between these organisms. We will talk more about these relationships later on. As of now we will just look at what really makes up an ecosystem and gets it working all the time. An ecosystem includes individual members of a particular species. When many members of the same species interact with each other, it is called a population. When various populations interact with each other, it is called a community. You may look at our fish tank in class as a perfect example. A community includes various types of species such as angel fishes, silver dollars, plants, goldfishes and others interacting in the same environment. When a community interacts with the non-living factors in an environment, it makes up an Ecosystem. For example, all the fishes and plants in the fish tank interacts with the water, rocks, light, driftwood and oxygen in the tank, it makes up a perfect Freshwater Ecosystem.

Food Web and Food Chains:

In an Ecosystem, all living things MUST obtain energy from other living things in order to stay ALIVE and REPRODUCE. Well, if we were to observe our fish tank in class we can very well see some of the interactions that take place. For example: The snails can eat the algae and then the catfish can eat the snail and then the silver dollar can eat the catfish. This one way interaction of these organisms is called a food chain. A Food chain shows the flow of energy from one organism to the next. In a Food web, the interaction is more diverse. That is, other organisms tend to feed on the same types of organisms in that particular ecosystem. For example, as mentioned above in the Food Chain, only the snail can eat the algae, however in a Food Web other organisms such as fungi and decomposing bacteria can also feed on the algae. Another web can be the silver dollar also eating snails and other small fishes in the tank other than JUST the catfish. You will tend to see that organisms that are at the top of all Food Pyramids will eat MORE than ONE type of organism. Why do you think that is ? Well, it is because by the time an organism at the top of the Food Pyramid gets its meal, its usually a limited amount of energy it can get from that organism that it just ate. It has to be able to eat other organisms so that it can get all the energy it needs for its survival. So, when organisms get eaten by more than one type of organism, it.s a Food Web. If it.s only a one way interaction, then it.s a Food Chain. Look at page 71 in your textbook to see how it works.

Water Cycle:

In all ecosystems, water and carbon is always in use. For example, plants and animals need water in order to survive. Also, when plants and animals die off, their remains are broken down by the Decomposers and returned to the soil as Carbon. The Carbon and water cycles play an important role in every ecosystem. So important a role, that without them, life on this planet will be impossible. The water cycle starts of in the clouds. When the sun shines and heats up the atmosphere, water from lakes, streams, rivers and even the sea is evaporated into the clouds. Evaporation is the process whereby water changes from a liquid to a gaseous phase by way of heat or sunlight. When this gas also called water vapor is cooled in the clouds, it then condenses and fall as Precipitation. Condensation is the process whereby water vapor gets cooled and changes from a gas to a liquid. Precipitation is anything type of matter that falls from the clouds as a result of condensation. The water, rain or snow that falls is quickly absorbed by the ground and the rest is used by plants and animals. This water also is sent into rivers and seas causing their water levels to rise. Humans as you may recall also use water for survival. We use water for drinking, cleaning and other useful necessities of life. Water can also be saved up for times when water is scarce. Reservoirs are huge dam like structures that are used for holding and saving water. Whatever water that is not used is quickly evaporated again by the sunlight and the cycle starts all over again.

The Carbon Cycle:

The Carbon cycle is also very important in the recycling of dead plants and animals. It also plays a very important role in keeping our atmosphere cool. As we learned previously, plants and animals share a Mutual relationship when plants release Oxygen and animals breathe in this Oxygen to survive. On the other hand, animals release Carbon Dioxide for which the plants use when they carry out Photosynthesis. When Humans use heat for cooking, or from burning gas and other fuels, they release a considerable amount of Carbon into the atmosphere. This level if mot controlled by plants and other human precautions can cause some serious problems. For example, recall that Carbon Dioxide cools our atmosphere. This is called the Green House effect because Carbon Dioxide gas acts like the window glass of a true greenhouse. It keeps the earth cool. However, when to much Carbon Dioxide gas is present, it causes the earth.s atmosphere to heat up a bit. This causes temperature changes and flooding in all parts of the world. When we talk about Global Warming, you will see then how this occurs. But for now just remember that Carbon is also important in any ecosystem.

The Nitrogen Cycle:

Nitrogen is an important element used in all ecosystems alike. Recall that Nitrogen is key component in DNA. Remember the Nitrogenous bases of DNA? Well these come from Nitrogen and without nitrogen we would certainly not have DNA. Well, Nitrogen too has to be recycled and reformed before we can use it. Plants use nitrogen in the form of ammonia. Humans remove excess nitrogen from our body in the form of Urea or Nitrogenous waste. Before plants can use ammonia, bacteria must first change Nitrogen gas to a form that the plants can use. This process where bacteria changes or fixes nitrogen gas to ammonia is called nitrogen fixation. So as you can see, plants and bacteria also share a mutual relationship where bacteria provides nitrogen for plants and plants in return provide nutrients and a home for the bacteria. Bacteria also play a role in breaking down dead plants and animals to a form of Nitrogen that is more usable by other organisms.

-->



Hosted by www.Geocities.ws

1