Palindromati

Fernando Castro-Chavez.

fdocc at yahoo dot com

Independent Biotechnologist.


Click here for the Spanish Version (en Castellano).


Reciente Entrevista (en español).


Recent interview (English.)


ABSTRACT

 

This article describes a family of artificial heterotranscripts (RNA chimaeras) composed by thousands of Genbank sequences containing fragments or the complete EcoRI-like adapter acting as the palindrome linker ctcgtgccgaattcggcacgag, binding together two or more genes that may be produced by different chromosomes. This happens due to current methodologies producing the reported sequences, found in the Genbank, in Affymetrix microarrays, and in many published articles reporting or using those sequences that include the EcoRI-like linker inside coding regions, and/or 5'UTR or 3'UTRs mRNA sites. This EcoRI-like linker and its heterotranscripts are here deemed as experimental artifacts, characterization that can be helpful to prevent errors, both in the studies of molecular mechanisms and in the drug discovery process.

 

Key words: EcoRI, Palindrome, Perilipin, Genbank, Affymetrix, microarray, species-specific.

 

INTRODUCTION

 

It is vital in the discovery of new medical treatments to target precise molecules without having side effects for organic tissues. To accomplish this objective it is necessary a stringent quality control within molecular databases. This article describes the finding of numerous methodological artifacts reported to the Genbank. It is recommended a most carefully analysis of nucleic acid sequences for biological, medical and drug discovery purposes.

 

A single RNA binding in one-strand two different genes from two different human chromosomes (1) was the theoretical beginning for the study on heterotranscripts.

 

Here, I define heterotranscripts as chimaeras, sequences composed by fragments corresponding to two or more genes from the same or from different chromosomes.

 

I thought that such a phenomenon reported in reference (1) must have been reflected in a rational and logical combination of Intelligently Designed gene products (2, 3). As most of the vital molecules and biological pathways are present in many organisms, I initially thought that the phenomenon described in reference (1) maybe should be present in many natural sequences as a possible functional common denominator.

 

I initially supposed that the study of sequences similar or related to the one present in reference (1) maybe could be helpful for our understanding of the molecular basis to biological change.

 

Thus, this particular phenomenon was a possible prospect for the abundance of proteins exceeding their number of genes via multiple modular combinations of diverse mRNAs. Recent estimates for humans reckon above a million of proteins produced by just 20,000 to 25,000 genes (4).

 

With these considerations in mind, my initial idea was that, if reference (1) was true, then the production of those numerous proteins could have had a putative process of RNA hetero-linkage at their formation.

 

However, after five years of comparing sequences, I came to realize that those hetero-sequences using that same oligonucleotide as its common linker were just methodological artifacts.

 

The common element of these chimeras is the linker ccgaattcgg (as presented in reference 1 inside the sequence L21934 for the H. sapiens ACAT-1 enzyme). This leaves references 1, 5 and 6 (if real), as a one and unique possible species-specific phenomenon in humans (2, 3).

 

Another article on the same sequence (1), has recently been published by the same group (5). Its authors mentioned since reference (1) the similarity of that linker with the EcoRI-adapter (a tool extensively used in molecular biology research), so the door still is open to verify whether this is a methodological artifact or not (5).

 

The initial construction of that sequence demonstrates that their cDNA library was transformed in E. coli (strain MC1061) using the phagemid vector pBluescript as well as with the expression vector pcDNA. Then, they retransformed it in the same E. coli strain (6), again. However, I have recently seen that the use of similar vectors can be involved in the production of chimerical artifacts in multiple instances, like in those examples presented in Tables 1 and 2 (7).

 

A possible, however remote, explanation for reference (1) is that we are dealing with a natural process, mostly restricted to humans. Yet, whatever the final verdict may be, the fact is that the EcoRI-like linker or adapter described in (1) was the starting point for the next findings, described in this article.

 

My personal hypothesis is that heterotranscripts or chimeras including the EcoRI-related palindromic linker ctcgtgccgaattcggcacgag or its related sequences, extending themselves to at least twelve bases, are artifacts from the molecular methodologies used, mainly mediated by its host-vector interactions.

 

RESULTS AND DISCUSSION

 

The finding of a related palindrome in Affymetrix microarrays

 

The basis for this article appeared while working with antiobesity microarrays. By studying the changes of gene expression in the obesity resistant perilipin knock out mice (8, 11), with the DNA-Chip Affymetrix MG-U74A-v2, analyzed using the free educational software dChip V.1.2 (9). One particularly intriguing hetero-transcript was the nucleotide sequence AB030505, initially reported by its submitters as the Mus musculus mRNA for UBE-1c1, UBE-1c2 & UBE-1c3 (complete cds). The following paragraph describes the sequence AB030505 and the common EcoRI-like linking element present in thousands of other Genbank sequences.

 

A careful study of the nucleotide sequence AB030505 using Blast (10) led me to an element that was linking two large sections from two different genes:

 

1. The nucleotide sequence AK078792 from chromosome 10, coding for a melanoma ubiquitous mutated protein homologue (Mum1) and

2. The nucleotide sequence BC036273 from chromosome 12, coding for retinol dehydrogenase 11 (similar to Arsdr1). The linking element within the sequence AB030505 corresponded to the palindrome ctcgtgccgaattcggcacgag, composed by 22 nucleotides.

 

Here again, as in the initial report (1), two transcripts originated in two different chromosomes were linked together in one mRNA strand. Those 22 bases contain the core palindromic linker ccgaattcgg at its center, which is similar to the one initially reported by reference (1).

 

A palindrome sequence for the double helix of DNA has the same nucleotides if read from 5' to 3', which is the normal reading direction, either from the plus (+) or from the minus (-) strand. A manual and visual assessment of this palindromic linker was done. Amazingly, this linker was present in thousands of sequences reported to the Genbank.

 

In the full Table 2 (7), I present many examples of the palindrome (or related sequences) being reported as if they were present inside coding regions. The palindromic linker mentioned is frequently translated as the artificial peptide RAEFGT, absent in sequenced protein databases (10).

 

Increase in the number of palindromic sequences reported to the Genbank

 

A monthly increase was seen in the number of sequences containing the EcoRI-like linker or its derivatives inside thousands of sequences. In one recent example (14 Oct. 2005) done in Blastn (nucleotide to nucleotide alignments), selecting the non redundant (nr) nucleic acid database sequences of Genbank, a query of 44 palindrome letters was used:

 

CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG

 

With this query, I obtainined 6010 Blast Hits using the next query conditions:

 

1. 106 as the minimum expected number. Some results are presented in Table 2 (7).

2. 1000 as the number of descriptions and of alignments.

 

In the Genbank's alternate database containing expressed sequence tags (est), which are mRNAs for putative proteins, the number of sequences containing the palindromic EcoRI-adapter is also present by the thousands.

 

Additional palindromes found by using microarrays

 

Additional targets pertaining to these linkers were also found while studying the results of microarrays available online using the software tool dChip (9) coupled to the Affymetrix probes databases. Table 1 shows examples containing the palindromic linkers.

 

Affymetrix has been a successful microarray methodology, i.e., to evaluate the gene expression in humans, mice, and rats. However, both the presence of artificial heterotranscripts and/or of their own artificial linkers can lead to a misrepresentation of its real expression inside the tissues, as the area under the curve is reduced for those genetic sequences.

 

Table 1. The EcoRI-related palindromic linker is present both in the Genbank sequence targets and in Affymetrix microarray probes for humans, mice and rats.

 

ID/ Organism

EcoRI Affymetrix Probes from Genbank [DNA Chip]

Graphic, non-expression of EcoRI-linker

Reference

AB002533_at

 

Homo sapiens

gaattcggcacgagcacgcgtgaga,

ggcacgagcacgcgtgagacttctc

 

 

[in the Human DNA Chips HuGene-FL and in Hu6800]

 

Ribosomal protein LP2 (Qip1)

Shipp et al, Nature Med.

8, 68. 2002

AJ243503

 

(99534_at)

 

Mus musculus

ttcggcacgagctcgtgccggtcct

 

 

[in the Mouse DNA Chips MG-U74Av2 and in MG-U74A]

Adipocyte

Ghrelin

Castro-Chavez et al. Diabetes 52, 2666. 2003

AI045710

 

(rc_AI045710_at)

 

Rattus norvegicus

atgatatgtacagatccctcgtgcc,

tgatatgtacagatccctcgtgccg,

tatgtacagatccctcgtgccgcct,

tgtacagatccctcgtgccgcctcg,

gtacagatccctcgtgccgcctcgt

 

 

[in the Rat DNA Chips RG-U34B}

Disulfide Isomerase related prot. (Erp70)

Children's National Medical Center Accesed Feb. 1, 2005.

Note: The EcoRI-related palindromic linker ctcgtgccgaattcggcacgag causes the drop of microarray expression to zero demonstrating its absence in the tissues [dChip V.1.2 (9)]. Highlighted in the second column in clear blue are the portions corresponding to the palindromic linker, and in dark blue, the nucleotides exchanged to obtain the second set or "mismatch" in Affymetrix' probes (DNA-Chip).


 

The phenomenon of heterotranscription

 

Twelve bases seem to be the minimum common denominator in order for the EcoRI palindromic linker to produce artificial heterotranscripts such as the ones reported here and present in the Genbank.

 

The most common palindromic flanks for the oligonucleotide ccgaattcgg are g and c, which give us the longer oligonucleotide gccgaattcggc. Less frequent are the flanks c and g to produce the second oligonucleotide cccgaattcggg, with a similar effect on heterotranscription. This last palindromic sequence is the one that we have in reference (1). The same palindromic sequence is present in example 9 from Table 2 (Homo sapiens X93499 for the RAB7 protein), in which we have fragments for more than two genes attached together in the same strand, through the palindromic linkers ccccgaattcgggg and gcccgaattcgggc (12).

 

Table 2. Transcripts with traces of an EcoRI related linker and some related references.

 

#
Accession/Organism
Gene/Protein *
Linker **
References ***

1

U58090

Homo sapiens

Cullin gene family member,

Hs-cul-4A

aattcggcacgagctcgtgccgct

NSARARAA

Cell 85, 829-839. 1996.

 

2

U28831

Homo sapiens

Protein immuno-reactive with anti-PTH polyclonal antibodies

gcacgagctcgtgccgat

ARARAD

Proc. Assoc. Am. Physicians 107, 296-305. 1995.

3

BC041619

Homo sapiens

Protein KIAA0404, for IMAGE:5923662 [R: hypoth. prot. MGC16044]

ccctcgtgccgaattcggcacgag

PSCRIRHE
Proc. Natl. Acad. Sci. U.S.A. 
99, 16899-16903. 2002.

4

AF176705 
Homo sapiens
F-box protein FBX10 (PINX1) 
[R: vector]
cctcgtgccgaattc
PRAEF
Curr. Biol. 9, 1180-2. 1999.
5

X85792

Homo sapiens

Vpr binding protein 1

tcgtgccgaattcggcacgag

SCRIRHE

Benichou et al. [Unpublished]; J Biol Chem. 277, 45091-8. 2002

6

AF151109

Homo sapiens

Putative BRCA1-interacting protein (BRIP1)

ggcacgagctcgtgccgc

GTSSCR

Wang et al. BRCA1-interacting protein. [Unpublished]; Oncogene 19, 6152-8. 2000.

7

AF146697

Homo sapiens

FOXP1

aagaattcggcacgagct

KNSARA

Cancer Res. 61, 8820-8829. 2001.

8

NM_002342

Homo sapiens

Gene and 3' UTR for TNFR superfamily, member 3 (LTBR)

gctcgtgccgaattc

 

Genomics 16, 214-218. 1993. [Curated by NCBI]

9

X93499

Homo sapiens

RAB7 protein, GTP-binding [L: Dystroglycan 1. C: Rab7. R: Envelope glycoprotein]

ccccgaattcgggg

& gcccgaattcgggc

Biochem. Biophys. Res. Commun. 229, 887-890. 1996.

10

X82200

Homo sapiens

Gene and mRNA for interferon-induced Staf50

gaattcggcacgagctc

J. Biol. Chem. 270, 14891-14898. 1995.

11

U31384

Homo sapiens

mRNA for G protein gamma-11 subunit

ggcacgagctcgtgccg

J. Biol. Chem. 270, 21765-21771. 1995.

12

AF379619

Homo sapiens

Intron near AB13, precursor mRNA

gaattcggcacgagct

van Roy and Staes. New human gene family. [Unpublished].

13

AY245868

Homo sapiens

CDS for Aldehyde oxidase-like protein (AOX2) pseudogene

aagaattcggcacgagca

LNSARA

Wright RM. Human aldehyde oxidase. [Unpublished].

14

AF339764

Homo sapiens

mRNA from Fetal liver spleen IMAGE:108721

gaattcggcacgagcggcacgagct

 

Genomics 79, 635-656. 2002.

15

U43527

Homo sapiens

5'UTR for Malignant melanoma metastasis-suppressor (KiSS-1)

(ctct)15cctcgtgccgaattcggcacgag

J. Natl. Cancer Inst. 88, 1731-1737. 1996; Genomics 54, 145-148. 1998.

Notes: This table presents the EcoRI related linker ctcgtgccgaattcggcacgag as it appears in the Genbank for some human genes. To view the rest of this Table 2 and the presence of the linker in other organisms, refer to URL: http://www.geocities.com/plin9k/t2.htm

* Gene/Protein (Gene symbol) [notes for sides of linker (L or R)]

** Linker and its Translation in Amino Acids as presented in the Genbank

*** Corresponding References According to the Genbank; closest related match

 

Abundance of sequences including the EcoRI-like palindromic linker

 

There are thousands of sequences, including expressed sequence tags (est) in the Genbank and in other nucleotide databases that still contain artifacts, having as its common denominators, EcoRI palindromic linkers like the ones described in this article.

 

The palindromic linkers can be present in tandems, halves, or in different lengths; being 12 to 24 bases its most common range. Artificial linkers have been found even inside multiple coding regions, like the examples presented in the full Table 2 (7). Examples of those linkers are frequently present outside the coding region, i.e, in promoters, like in:

 

1-) NR_001557 for H. sapiens aldehyde oxidase 2 (AOH2) on chromosome 2, oligo gaattcggcacgagc (13).

2-) NM_002342 H. sapiens lymphotoxin beta-receptor (LTBR; member 3 of the TNFR superfamily), oligo gctcgtgccgaattc (14).

 

Furthermore, those palindromic linkers have been found also in the 5' region, i.e., in sequence U43527 for the human malignant melanoma metastasis-suppressor KiSS-1, oligo (ctct)15cctcgtgccgaattcggcacgag (15), and/or in the 3' region, i.e., sequence AY029161 for the Pin2-interacting protein X1, oligo ctcgtgccgaattcggcac (16).

 

Of the few submissions to the Genbank that are explicitly reporting the presence of the EcoRI adapter, Hirama et al (17) stands out, together with Inoue et al (18) and Savas et al (19). However, Inoue et al (18) considers only the 8 first bases at the left flank as part of the sequence for the EcoRI-adapter. The effect of the palindromic linker for Inoue's sequence may extend to at lest 16 bases (sequence D83948 for S1-1 protein, oligo ggcacgagctcgtgccg) by an apparent phenomenon of self-recombination and self-insertion inside the host-vector interactions.

 

A similar situation to what we see in Inoue's is presented by Savas et al (19), mentioning in their Genbank submission the first 6 bases only as part of the EcoRI-adapter (same in reference 1, but not in the submitted sequence L21934). In Savas' reference (19) the linker-like effect may be extended about 20 bases (sequence X78445 for Cytochrome P450 Cyp1-b-1, oligo gaattcggcacgaactcgtgc). Hirama et al (17) is the only one that appropriately mentions a longer extension for the EcoRI-adapter, reporting it as being of 14 bases (sequence X56703 for the rearranged T-cell receptor alpha chain, oligo gaattcggcacgagct).

 

Chimaeras linked by the EcoRI-like palindrome seem to be resistant to enzymatic digestion

 

The palindromic linkers persist in the sequences without being digested by the enzymes. The discovery of mechanisms of resistance to the enzymatic digestion awaits further study. However, it is evident that the most common palindromic linkers match the identity of the EcoRI adapter sequence gaattcggcacgag, which is used for the 5'UTR, and reported to the Genbank, i.e., inside the sequence AI607511 as ctcgtgccgaattcggcacgag (similar to acidic ribosomal phosphoprotein PO). In that sequence, it is indicated the use of the vector pBluescript SK(-), plus EcoRI, with the additional use of the vector Uni-ZAP XR. These methodologies, like the ones described in (1, 5, 6), may be promoting the phenomenon of artificial linkage abundantly present in the Genbank.

 

The rearrangement and splicing in a host-vector interaction resistant to EcoRI enzymatic digestion may be explained by a phenomenon of self-hybridization performed by the linker (Figure 3), which could make it to appear as an appendage impossible to be grasped by the digestive enzyme.

 


 


Figure 3. Self-hybridization of the palindromic EcoRI-like linker seems to block enzymatic digestion. Phenomenon also seen as 'a closing zipper', at both ends of longer sequences, where two distant parts of the linker approach and stick together producing a plasmid-like formation. [Examples 38-42, full Table 2 (7). Figure obtained using the software from reference 20.]

 

CONCLUSIONS AND PERSPECTIVES

 

Stringent quality control on sequence databases is required

 

These findings may contribute to a more stringent implementation of a quality control within nucleotide databases, as well as the professional analysts of molecular artifacts and related experiments, not to mention the rational human engineering of pharmaceutical drugs and proteins. We must first tame, through its controlled use, those palindromic linkers. Then, the use of sequence quality control (to detect those molecular artifacts) can successfully be applied. Improvements can be made in the design of Affymetrix microarrays, i.e., by removing the palindromic linker from human sequences such as AA557228, AA113291, AI798671, AA864645, AA780435, W90032, AA810599, T52176, AA976510, AI380906, AA535275, AI792166, T67559, L04270, U83598, D59474, T03148, T54342, D59674, D59787, D80164, H90908, N80129, C14426, D59619, D80240, T56800, C14298, W72424, IR1056496, T69555, D80337, C14227, C14407, C14344, D80210, etcetera.

 

Possible use of palindromes and its heterotranscripts to reverse hereditary diseases

Another possibility is the use of palindromes for the attachment of two different genes (genetic modules) for the engineering of therapeutic proteins, i.e., for the engineering of antiobesity treatments that may be customized and prescribed according to the particular metabolism of each person (21).

 

Artificial vectors for gene therapy may produce heterotranscription

 

It is possible that palindromic linkers like the ones reported in this article, or using other linkers, may be produced by artificial vectors for gene therapy also. If this is the case, an unsuspected side effect for humans may result. To date, those linkers are still present in those thousands of artificial sequences submitted to the Genbank, and are an allegory of things that can be prevented in human gene therapy. This article has been written to raise the awareness to the scientific community on the presence of these thousands of artificial hetero-transcripts by current methodologies producing the sequences reported to the Genbank as well as the vectors used in gene therapy.

 

Published and submitted heterotranscripts are still awaiting its correction

 

In doing an analysis of the sequences presented as chimerical mRNAs in Table 4 of reference (22), I also found in that article the EcoR1-related palindromic linker present inside the sequence AY029161 (16), already seen. In that sequence, there is a fragment for a putative human tumor suppressor LPTL, AF418553, originated in the human chromosome 8, and linked with a fragment for phosphohistidine phosphatase PHP14, NM_014172 originated in the human chromosome 9.

 

Until the submission of this article, none of the sequences presented here had been corrected in the Genbank. Could this be because they have not been determined as artifact products to date?

 

Another sequence in reference (22) that contained the EcoR1 related palindromic linker was BC000519, identified as an artifact and has already been removed from the Genbank.

 

A possible transposon-like removal of palindromic linkers seem to have happened on other chimeras

 

Awaiting correction are thousands of sequences like the ones presented in Table 2 (7). Sequences like AF176705 for the human F-box protein FBX10 (23), and Z28355 from the atrium heart (24), are both containing fragments of the vector and of the linker. Another sequence, HTCBYB08, contains fragments of the vector only, lacking the linker. Experiments were also done with such sequences lacking any evidence of a palindromic linker, also without obtaining amplified products by RT-PCRs (unpublished results). Both of the sequences Z28355 and HTCBYB08 exhibit traces of the same cloning vector, vector from the sequence X52324 (ARBLSKM), the pBluescript SK(-) vector (25-27). A transposon-like self-removal of the palindromic linker may be one way in which many heterotranscripts appear to be lacking the linker, as in the sequence HTCBYB08. This hypothesis also needs to be experimentally evaluated. If this is the case, palindromic linkers may be used for a possible artificial reversal of mutations in vivo (28).

 

On the other hand, heterotranscripts lacking the linker, and present in Affymetrix' microarrays, may show two different expression profiles, for example, a zero expression on one side while a contrasting higher expression on the other side (data not shown). A similar pattern is present when non-expressed introns are included within Affymetrix' probes side by side with sequences expressed by the exons, as in Figure 1 from reference (2).

 

Final comment

 

The key palindrome described in this article has already been introduced in reference (2) as CTCGTGCCGAATTCGGCACGAG and it has been reported elsewhere (2, 3, 29), also.

 

ACKNOWLEDGMENTS

 

Tracy Lynn Duncan helped in preparing this review and supported me during the last two years.

 

REFERENCES

1. Li BL, Li XL, Duan ZJ, Lee O, Lin S, Ma ZM, Chang CC, Yang XY, Park JP, Mohandas TK, Noll W, Chan L & Chang TY (1999) Human Acyl-CoA:Cholesterol Acyltransferase-1 (ACAT-1) gene organization and evidence that the 4.3-kilobase ACAT-1 mRNA is produced from two different chromosomes. J. Biol. Chem. 274: 11060-11071.

2. Castro-Chavez F (2004) Microarrays, antiobesity and the liver. Ann. Hepatol. 3: 137-145. [http://www.medigraphic.com/pdfs/hepato/ah-2004/ah044c.pdf]. Accessed Oct. 1, 2005.

3. Castro-Chavez F (2004) Some Implications for the Study of Intelligent Design Derived from Molecular and Microarray Analysis. PCID 3.1.7 (serial online), November, Issue 3. [http://www.iscid.org/pcid/2004/3/1/pcid_contents_2004_3_1.php]. Accessed Oct. 1, 2005.

4. International Human Genome Sequencing Consortium (2004) Finishing the euchromatic sequence of the human genome. Nature 431: 931-45.

5. Yang L, Lee O, Chen J, Chen J, Chang CC, Zhou P, Wang ZZ, Ma HH, Sha HF, Feng JX, Wang Y, Yang XY, Wang L, Dong R, Ornvold K, Li BL & Chang TY (2004) Human acyl-coenzyme A:cholesterol acyltransferase 1 (acat1) sequences located in two different chromosomes (7 and 1) are required to produce a novel ACAT1 isoenzyme with additional sequence at the N terminus. J. Biol. Chem. 279: 46253-62.

6. Chang CC, Huh HY, Cadigan KM & Chang TY (1993) Molecular cloning and functional expression of human acyl-coenzyme A:cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells. J. Biol. Chem. 268: 20747-55.

7. Castro-Chavez F (2005) Full version of Table 2. Website. [http://www.geocities.com/plin9k/t2.htm]. Accessed Oct. 1, 2005.

8. Castro-Chavez F, Yechoor VK, Saha P, Martinez-Botas J, Wooten E, Sharma S, O'Connell P, Taegtmeyer H & Chan L (2003) Coordinated upregulation of oxidative pathways and downregulation of lipid biosynthesis underlie obesity resistance in Perilipin knockout mice. A microarray gene expression profile. Diabetes 52: 2666-2674. [http://diabetes.diabetesjournals.org/cgi/content/full/52/11/2666]. Accessed Oct. 1, 2005.

9. Li C & Wong WH (2001) Model-based analysis of oligonucleotide arrays: expression index computation and outlier 
detection. Proc. Natl. Acad. Sci. U.S.A. 98: 31-36. [http://biosun1.harvard.edu/complab/dchip]. Accessed Oct. 1, 2005.
10. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W & Lipman DJ (1997) Gapped BLAST and 
PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25: 3389-3402 
[http://www.ncbi.nlm.nih.gov/BLAST]. Accessed Oct. 1, 2005.
11. Castro-Chavez F (2004) El Incremento Coordinado de las Rutas Metabolicas Oxidativas y la Disminucion en la 
Biosintesis de Lipidos Caracterizan la Resistencia a la Obesidad en el Raton Artificialmente Carente de Perilipina. 
Doctoral thesis, Universidad de Guadalajara, Guadalajara, Jalisco, Mexico. 
[http://www.geocities.com/plin9k/tesis-fdocc.zip]. Accessed Oct. 1, 2005.
12. Vitelli R, Chiariello M, Lattero D, Bruni CB & Bucci C (1996) Molecular cloning and expression analysis of the human 
Rab7 GTP-ase complementary deoxyribonucleic acid. Biochem. Biophys. Res. Commun. 229: 887-890.

13. Terao M, Kurosaki M, Marini M, Vanoni MA, Saltini G, Bonetto V, Bastone A, Federico C, Saccone S, Fanelli R, Salmona M & Garattini E (2001) Purification of the aldehyde oxidase homolog 1 (AOH1) protein and cloning of the AOH1 and aldehyde oxidase homolog 2 (AOH2) genes. Identification of a novel molybdo-flavoprotein gene cluster on mouse chromosome 1. J. Biol. Chem. 276: 46347-63.

14. Matsuda A, Suzuki Y, Honda G, Muramatsu S, Matsuzaki O, Nagano Y, Doi T, Shimotohno K, Harada T, Nishida E, 
Hayashi H & Sugano S (2003) Large-scale identification and characterization of human genes that activate NF-kappaB and 
MAPK signaling pathways. Oncogene 22: 3307-3318.

15. West A, Vojta PJ, Welch DR. & Weissman BE (1998) Chromosome localization and genomic structure of the KiSS-1 metastasis suppressor gene (KISS1). Genomics 54: 145- 148.

16. Zhou XZ & Lu KP (2001) The Pin2/TRF1-interacting protein PinX1 is a potent telomerase inhibitor. Cell 107: 347-359.

17. Hirama T, Takeshita S, Matsubayashi Y, Iwashiro M, Masuda T, Kuribayashi K, Yoshida Y & Yamagishi H (1991) Conserved V(D)J junctional sequence of cross-reactive cytotoxic T cell receptor idiotype and the effect of a single amino acid substitution. Eur. J. Immunol. 21: 483-488.

18. Inoue A, Takahashi KP, Kimura M, Watanabe T & Morisawa S (1996) Molecular cloning of a RNA binding protein, S1-1. Nucleic Acids Res. 24: 2990-7.

19. Savas U, Bhattacharyya KK, Christou M, Alexander DL & Jefcoate CR (1994) Mouse cytochrome P-450EF, representative of a new 1B subfamily of cytochrome P-450s. Cloning, sequence determination, and tissue expression. J Biol Chem. 269: 14905-11.

20. Zuker M. (2003) Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31: 3406-15.

21. Qi L, Shen H, Larson I, Schaefer EJ, Greenberg AS, Tregouet DA, Corella D & Ordovas JM. (2004) Gender-specific association of a perilipin gene haplotype with obesity risk in a white population. Obes. Res. 12: 1758-65.

22. Romani A, Guerra E, Trerotola M & Alberti S (2003) Detection and analysis of spliced chimeric mRNAs in sequence databanks. Nucleic Acids Res. 31, e17: 1-8.

23. Winston JT, Koepp DM, Zhu C, Elledge SJ & Harper JW (1999) A family of mammalian F-box proteins. Curr. Biol. 9: 1180-1182.

24. Auffray C, Behar G, Bois F, Bouchier C, Da Silva C, Devignes MD, Duprat S, Houlgatte R, Jumeau MN, Lamy B (1995) IMAGE: molecular integration of the analysis of the human genome and its expression. C. R. Acad. Sci. III, Sci. Vie. 318: 263-72.

25. Short JM, Fernandez JM, Sorge JA & Huse WD (1988) Lambda ZAP: a bacteriophage lambda expression vector with in vivo excision properties. Nucleic Acids Res. 16: 7583-7600.

26. Alting-Mees MA & Short JM (1989) pBluescript II: gene mapping vectors. Nucleic Acids Res. 17: 9494.

27. Alting-Mees MA, Sorge JA & Short JM (1992) pBluescriptII: multifunctional cloning and mapping vectors. Meth. Enzymol. 216: 483-495.

28. Hirschhorn R (2003) In vivo reversion to normal of inherited mutations in humans. J. Med. Genet. 40: 721-728. [http://jmg.bmjjournals.com/cgi/content/full/40/10/721] Accessed Oct. 1, 2005.

29. Castro-Chavez F (2005) Genes involucrados en la susceptibilidad a la obesidad y los genes anti-obesidad. In: Mendez-Sanchez N (Editor), OBESIDAD. Epidemiologia, Fisiopatologia y Manifestaciones Clinicas. 2nd Ed. Manual Moderno. Mexico (in press).

 

////////////////////////////////////////////////////////////////

 

Notes:

 

The PDF of this work 'Palindromati' can be found at:

 

http://www.iscid.org/boards/ubb-get_topic-f-6-t-000582.html

 

Mendelian Bioengineering:

 

http://www.geocities.com/plin9k/bioeng.htm

 

http://www.geocities.com/plin9k/limiting-species.htm


Links to the Biggest Forensics Thus Far.


Blog 'Research on Intelligent Design':

 

http://fdocc.blogspot.com

 

The Index # 1 for my Blog 'Research on Intelligent Design':

 

http://www.geocities.com/plin9k/roid1.htm


The Index # 2 for my Blog 'Research on Intelligent Design':

 

http://www.geocities.com/plin9k/roid2.htm


The Index # 3 for my Blog 'Research on Intelligent Design':

 

http://www.geocities.com/plin9k/roid3.htm


Tasters of the Word (YouTube), videos recientes: "Astronomía y Nacimiento de Jesucristo: Once de Septiembre Año Tres A.C.", "Estudio sobre Sanidades" (en 20 episodios), "Jesus Christ, Son or God?":http://www.youtube.com/1fertra


Tasters of the Word (the blog, with: "Astronomy and the Birth of Jesus Christ"):http://fertra1.blogspot.com

Hosted by www.Geocities.ws

1