Cytochrome b gene of each species (FASTA format) were received from NCBI website and save in file which composed of

Bovine (Bos indicus)
Chicken (Gallus gallus)
Dog (Cynomys ludovicianus)
Dugong (Dugong dugong)
Frog (Mantella aurantiaca)
Human (Homo sapiens)
Magpie (Pica pica)
Mouse (Acomys spinosissimus)
Rabbit (Brachylagus idahoensis)
Rhinocerous (Rhinoceros sondaicus)
Sicklebill (E.fastuosus)
Whale (Balaenoptera musculus)
 

Query sequence
Dinosaurs' s cytochrome b sequence
cccttctattattcattctcattctattcgttattcttgtactccacacatccaaacaacaaagcataatattccacccattgagtccattcctatcctgattcttagtccccgaaccttttacactcacatg
 

• Clustal X(version 1.83), Phylip(version 3.6) and Treeview package were employed in analysis and tree construction because they are suitable for MS-Windows.

• The first step is sequence alignment by CLUSTAL X package.

Sequences loading after open clicking.

Sequences were aligned by multiple alignment mode and got phylip output file and guide tree which shown below (guide tree can be seen by Treeview package).

Seqboot program was employed in data replication

The number of data set is 500 (push "R" + enter) and random seed number was set at 777. Then, Output was received after push "Y" and enter, the result can be seen by text editor.(example see below)

Output file after bootstrapping was changed into "infile" and analyzed by dnadist program(distance matrix).

 

Distance parameter was changed into Kimura 2-parameter. (push "D" and enter)
Matrix was changed into low-triangular parameter. (push "L" and enter)
Multiple data set was set for 500 replication. (push "M" and enter, "D" and enter, 500 filling)
Output was received after push "Y" and enter. Analyzed data can be seen by text editor. (example see below)

 

Output file after distance analysis (dnadist program) was changed into "infile" and analyzed by neighbor.exe which gave genetic relationship information.

The outgroup was set at 12. (push "O" and enter, 12 filling).
Started data was set at lower-triangular (push "L" and enter).
Multiple data set was set for 500 replicates and 777 random number seed.
Output (outfile and out tree) was received after push "Y" and enter

Outfile and out tree consist of 500 fashion data set. (Outfile see below)

One set of 500 sets output.

Five hundred tree can be seen by treeview package.

The outgroup was set at 12. (push "O" and enter, 12 filling).
Root tree output was set by push"R" and enter.
Final output (outfile and outtree) was received by push"Y" and enter.

Output file can be seen by text editor.(see below)

Out tree was seen by treeview package which possess many fashions of tree.

Cladogram fashion

Rectangular cladogram fashion

From phylogenic tree which is constructed by phylip package (distance matrix) based upon cytochrome b gene can be concluded that;

Dinosaur is closely with frog (Mantella aurantiaca) and speciated from human and chicken (Gallus gallus).

Created by Patiya Pengon

4737611 SCFS/M

Forensic Science, Facult of Science, Mahidol University