SBIOAC BIOLOGY                                                  Molecular Genetics

 

Name:                                              .                                       2003 06 02

 

Read each question carefully. Answer all questions, as no marks will be deducted for incorrect responses.

Value of question appears in parentheses after the question.

Total = 50

 

            1.   The two polynucleotide strands in a DNA molecule are like the east-west

            lanes of the 401 highway because they show

A.  cloverleaf structures

B.  they are constantly under repair

C.  a helical structure

D.  anti-parallel orientation

 

            2.   A nucleotide is added to a growing chain by means of a (A)                  bond          

and it is always attached   to the (B)            end of the existing chain. Choose one         answer only.

                        (A)                                           (B)

A.  phosphodiester                                     3’

B.   phosphodiester                                    5’

C.  hydrogen                                              3’

D.  peptide                                                 3’

 

           3. Which of the following is NOT an absolute requirement for DNA replication to

           take place?

A.  single-stranded DNA

B.   RNA primer

C.  DNA polymerase

D.  ribosomes

 

            4. DNA contains different genes that are transcribed into all of the following EXCEPT:

A. proteins       B.  mRNA        C.   rRNA         D.  tRNA           

 

            5.   mRNA is synthesized by

A. replication       B. duplication        C.   transcription       D.  translation

 

            6.          carries coded instructions for amino acid sequence to the ribosomes.

A. mRNA         B.  rRNA        C.  ribosomes       D.  tRNA

                                                                                                                       

            7.  tRNA:

 

A. delivers amino acids to ribosomes

B. picks up genetic messages from rRNA

C. synthesizes mRNA

D. all of the above

 

            8.   How many amino acids are coded for in this mRNA sequence?      

CGUUUACACCGUCAC

A. six       B. five       C.  seven          D.  fifteen        E. four

 

            9.    An anticodon pairs with the nitrogen-containing bases of :

A. mRNA codon      B.  DNA codons         C.  tRNA anticodon    D.  amino acids

 

            10.  Each codon specifies a(n) :

A. protein      B.  polypeptide       C.  amino acid         D.  carbohydrate

 

            11.   The loading of mRNA onto a ribosome occurs during the          stage of     translation.

            A. initiation    B. elongation     C. termination     D. transcription

 

12.   Match the terms related to protein building (6)

 

   F  disrupts genetic instructions            A.  initiation, elongation, termination

   C   genetic code word                       B.  polypeptides are synthesized

   D   transcription                                 C. base triplet for an amino acid

  B    translation                                    D.  one DNA strand is template for the process

   A   translation stages                          E.  amino acid is attached to acceptor end

  E     tRNA activation                          F.  gene mutation

 

            13.    In eukaryotes, the non-translated portion of a gene is called:

 

A. transcript                 C.  replicon     

B. intron                       D.  exon

                                                                                                                                   

            14.    Which does not occur inside the nucleus?

A. transcription                         C.  translation

B. rRNA synthesis                    D.  splicing

 

15. For the amino acid cysteine, give (3)

                        The mRNA codon       UGC or UGU        .

                        The DNA triplet          ACG or ACA         .

                        The tRNA anticodon     ACG or ACA        .

 

            16. Which of the following statements regarding DNA replication is incorrect?

 

A. DNA polymerase can start only at the 3’ end of the old DNA strand.

B. DNA polymerase requires an RNA primer.

C. DNA replication is always in the 5’ ® 3’ direction

D. DNA replication is always in the 3’® 5’ direction.

 

17.       From this diagram, identify the leading and lagging strands. Use the initial

primer (P) as reference (2).

 

 

 

 

 

 

 

 

leading:         I  &          IV        .           lagging     II         &       III        .          

 

 

18. Using the genetic code, translate the following portion of a gene.  Show the orientation of each product (3)

 

            DNA   3’  TTAGCGTGGAGACTTACTGTA  5’

 

 

            mRNA 5’ AAU CGC ACC UCU GAA UGA CAU 3’     UGA means STOP CHAIN!

 

 

            Protein   N-asparagineargininethreonine – serine – glutamate - C

 

 

        19. DNA and RNA have similar structures in that both molecules __________.                            

A.  are double helices

B. have either purines and pyrimidines in their structures

C. have five kinds of nitrogenous bases in their structures

D. have a sugar-phosphate backbone with bases attached to the sugars

 

        20. DNA is different from RNA in that DNA, but not RNA, __________

 

A.  is single-stranded

B.  binds a purine only to ribose and a pyrimidine only to deoxyribose.

C.  has two kinds of sugars rather than one.

D. has deoxyribose

 

        21. Which does not occur in prokaryotes?

 

A. transcription   B. tRNA activation       C. translation      D. mRNA processing

 

            22. The process of protein synthesis occurs in

            A. bacteria only

            B. eukaryotes only

            C. plants only

            D. animals only

            E. all living things

                                   

            23. Frame shift mutations are caused by

            A. base additions

            B. base deletions

            C. substitutions

            D. a and b only are correct

                                                                                                                       

            24. During polypeptide elongation, each amino acid to be incorporated is first

carried to the          

            A. interior of the small ribosomal subunit

            B. P site of the large ribosome subunit

            C. A site of the large ribosome subunit

            D. 5’ end of the bound mRNA

 

            25. The structures called snRNPs are . . .

A.  a type of specialized carbohydrate.

B.  involved in the removal of exons from DNA.

C.  a critical component of the initiation complex.

D.  part of a spliceosome.

 

            26. What happens to the RNA primers that are essential for initiation of DNA replication?

 

A. the RNA nucleotides are replaced by DNA nucleotides

B. The pieces of primer become a permanent part of the DNA molecule

C. RNA primase removes each primer, which is then replaced by a DNA primer

D. When the RNA primers are removed, they become known as Okazaki fragments.

 

        27. In this diagram of the process of DNA replication at a replication fork, the strand labeled B is the:

A. leading strand

B. lagging strand

C. Okazaki fragment

D. template strand

 

 

        28. In the diagram above of the process of DNA replication at a replication fork, the black boxes labeled D and E are:

A. RNA primers

B. DNA template strands

C. Okazaki fragments

D DNA polymerase

 

            29. Which mRNA codes for the following polypeptide? met arg ser leu glu

 

A.

3'-AUGCGUAGCUUGGAGUGA-5'

B.

3'-AGUGAGGUUCGAUGCGUA-5'

C.

5'-AUGCGUAGCUUGGAGUGG-3'

D.

1'-AUGCGUAGCUUGGAGUGA-3'

 

 

                                                                                                                        /6

        30. For the DNA strand 5'-TACGATCATAT-3' the correct complementary DNA strand is:

 

A.

3'-TACGATCATAT-5'

B.

3'-ATGCTAGTATA-5'

C.

3'-AUGCUAGUAUA-5'

D.

3'-GCATATACGCG-5'

E.

3'-TATACTAGCAT-5'

 

 

        31. With what mRNA codon would the tRNA in the diagram be able to form a codon-anticodon base pairing interaction?

A.

3'-AUG-5'

B.

3'-GUA-5'

C.

3'-CAU-5'

D.

3'-UAC-5'

 

 

 

            32. During translation in eukaryotes, anticodons on the tRNAs

A. never bind to the mRNA codons

B. ensure that each amino acid is delivered to its proper "address" on the mRNA

C. assist in the assembly of fats

D. consist of a three-nucleotide sequence at the 3’ end of the transfer RNA molecule

 

            33. As amino acids are added to the protein chain, they are held together by

 

A. peptide bonds

B. hydrogen bonds

C. ionic bonds

D. water molecules

 

            34. Initially, every polypeptide chain formed in translation begins with the amino acid

            A. tryptophan

            B. glutamine

            C. methionine

            D. phenylalanine

 

            35. Introns which are spliced out of pre-mRNAs are not translated into polypeptides because

 

A. they are not capped or polyadenylated or transported from the nucleus

B. they never contain a codon for methionine

C. they do not contain nucleotides

D. they turn into other types of RNA

 

36. Match the following with their role in translation (5)

a. start codon

b. initiation complex
c. tRNA
d. anticodon
e. P-site of ribosome
f. A-site of ribosome
g. nonsense (stop) codon
h. release factors

___d__ A series of three tRNA bases complementary to a mRNA codon
___f__ The ribosomal site where a tRNA carrying an amino acid first attaches during translation

__e___ The ribosomal site where the growing amino acid chain is temporarily being held by a tRNA as the next codon in the mRNA is being read

 

__g___ A series of three mRNA bases coding for no amino acid

 

    c      Transports amino acids to the ribosome during translation

 

BONUS (2)

 

 

Hosted by www.Geocities.ws

1