1) Plasmid DNA template is isolated from a dam+ strain. The plasmid DNA is methylated at GATC sequences.
2) A PCR reaction with primers that contain the mutation is run over the whole plasmid template (WHOPS - whole plasmid synthesis). The PCR generates non methylated plasmids with two nicks.
3) The restriction enzyme DpnI cleaves at GAmetTC sequences, digests the methylated wild type plasmids and removes the background of unmutated plasmids. The residual plasmids are transformed into E. coli where the nicks become repaired. The colonies can then be screened for plasmids with the correct mutation.
The procedure in the kit manual seems to be optimized to make things as expensive as possible. The changes we introduced are listed below: Only Pfu turbo polymerase and DpnI restriction enzyme are required. The kit recommends to use HPLC purified primers. However, we used unpurified standard primers and encountered no problems. Also it seems to be unnecessary to run a 50 ml PCR reaction if only 1 ml is going to be transformed. 20 ml reactions were run instead. It is also unnecessary to use Xl1-blue cells only, as most cloning strains will do. The transformation method is more important; heat shock transformation gave around 50 x more colonies than electroporation.
The site of mutation was put in the middle, and 12 to 15 matching base pairs were introduced at both sides. The codons at the site of mutation were chosen to fit the template as well as possible. Where possible, a silent restriction site was built in the primer to facilitate the screening of the mutants using the program under silentmutations. It was not considered in what kind of base the primer ends (triple A at the 3' end worked also well). The annealing temperature of these primers in theory lies above 78 �C( primer calculator, Ta(3)). In practice, annealing temperatures between 60 �C and 68 �C gave the desired PCR products. The two primers are complementary to each other.
Example: KpnI 5'-TTTTACTCCAGGTACCCCCTTTCACCTTATTCCTGATGACTG-3' ||||||||||||||| | |||| | ||||||||||||||| CCCAAAATGAGGTCCATGAGCGAAACTCCTATAAGGACTACTGACCAC GGGTTTTACTCCAGGTACTCGCTTTGAGGATATTCCTGATGACTGGTG ||||||||||||||| | |||| | ||||||||||||||| 3'-AAAATGAGGTCCATGGGGGAAAGTGGAATAAGGACTACTGAC-5'
Reaction mixture:
2 ml | 10x Pfu buffer |
8 ml | dNTP 0.5 mM |
0.5 ml | Miniprep DNA ( ca 100 ng) |
1 ml | forward primer 10 pmol/ml |
1 ml | reverse primer 10 pmol/ml |
7.1 ml | water |
0.4 ml | Pfu turbo polymerase (2.5 u/ml ) |
PCR Program:
Pfu turbo polymerase (Stratagene) was the last component added to the mixture, since its exonuclease activity may degrade single stranded primers. Because Pfu polymerase shows little polymerization activity at room temperature, a hot start PCR is not necessary. After mixing, the PCR tube was vortexed briefly and put into the thermocycler. After completion of the program, 5 ml of the PCR reaction were run on a 1 % agarose gel.
Selection against wild-type plasmids:
If a band with the size of the template plasmid was visible on gel, the residual 15 ml of the PCR reaction were transferred into a sterile eppendorf tube, 0.4 ml DpnI restriction enzyme were added (10 u/ml ), the mixture was vortexed and spun (this is important to get all DNA in contact with the restriction enzyme so the background can be eliminated - just adding the restriction enzyme to the PCR tube without spinning down may lead to a high background of wild-type plasmids), and then incubated at 37 �C for 90 min.
Transformation:
1 ml of the mixture was then taken for heat shock transformation into chemically competent cells (TOP10). Electroporation into DH10B worked also, but resulted in a rather low number of colonies.
When longer primers are attempted (multiple and cassette mutagenesis, insertions and deletions), the mutagenesis efficiency is drastically decreased due to the more favorable primer dimer formation (100% complementary) compared to the primer-template annealing (due to multiple mismatches). The procedure consists of two stages. In stage one, two extension reactions are performed in separate tubes; one containing the forward primer and the other the containing the reverse primer.1-10 cycles are run. Subsequently, the two reactions are mixed, and the standard QCM procedure is carried out on the mixture.