R1b1c1 aka M37

 

John McEwan

24 October 2006

 

Background

M37 is a SNP that defines subclade R1b1c1 in the ISOGG 2006 Y chromosome tree.

 

Technical details

The SNP was described by Underhill et al (2001) as

 

M37 C->T 203 cagattggattgatttcagcctt agcatacaaaaaaaaaaaactgc

 

Using May 2006 Golden Path and in silico PCR the following sequence was obtained from Yq11.222. Attempts to retrieve it from DbSNP suggested the primers also amplify rs34289137 at location 20210837 of NCBI Build 36.1 (green below). Cross checking has identified that this is M61 which defines haplogroup L. The M37 mutation itself was manually annotated (yellow below). The C allele is ancestral.

 

>chrY:20210737+20211158 422bp CAGATTGGATTGATTTCAGCCTT AGCATACAAAAAAAAAAAACTGC
CAGATTGGATTGATTTCAGCCTTcttctggtactttttaaaatcttatta
atcattaggaaaagaagttttattattgatgcaagccctaaacactcttt
[c/t]gactccagaggagaagctggcagctctctgtaagaaatatgctgatctt
gtgagtatttatttaatggagcaaggaacacagaaaataaaatctatgtg
tg[c/t]ttgataagatttttaaatattattttgatgtaactttaaatgtaaaa
tgatattttatctcaaaattgaaaacaatctcctttctttagtacttatg
attggtgtgtgtgacttcatcttatgaaatgatgtatagaacataataat
acttttttaaatgtgaaataaatttcctaaaacttaatatgctagatcaG

CAGTTTTTTTTTTTTGTATGCT

 

Occurrence

It was first described by Underhill et al (2000) where it was reported in 2 people both “Australian” after genotyping 1062 individuals from a variety of countries. The Australians were presumably aborigine (but perhaps admixed). The SNP was originally detected scanning a global population of 53 individuals.   To date even though it has been tested in at least 7 studies and many thousands of people no further derived individuals have been found. Interestingly another SNP rs34289137 has been recently found nearby consisting of a C/T mutation and has been reported to be derived in 2 out of 44 individuals from a world wide sampling, one from North America and another from a multi-national group.

 

Unresolved issues

·          I find it strange that it was found in a screen of 53 people and then in several Australians (unstated but likely “aborigines” presumably via European admixture) and never observed again.

·          It is interesting a similar type of SNP M61 has recently been found independently just 102 bp away in 2 out of 44 individuals from a diverse world wide sample.

 

Summary

It is suggested that if the original samples are still available they are resequenced to confirm the SNP location and also tested against the current R1b ISOGG SNPs to confirm its position in the ISOGG tree.

 

References

Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ. 2000. Y chromosome sequence variation and the history of human populations. Nat. Genet. 26:358-361

Underhill, P.A., Passarino, G., Lin, A.A., Shen, P., Mirazon Lahr, M., Foley, R.A., Oefner, P.J. and Cavalli-Sforza, L.L. 2001. The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations. Ann. Hum. Genet. 65: 43-62.

 

 

 

 

 

Hosted by www.Geocities.ws

1