R1b1c5 aka M160

 

John McEwan

23 October 2006

 

Background

M160 is a SNP that defines subclade R1b1c5 in the ISOGG 2006 Y chromosome tree.

 

Technical details

The SNP was described by Underhill et al (2001) as

 

M160 A->C 251 cagaataataggagaatttttggt attttccttattttctaagcagc

 

Using May 2006 Golden Path and in silico PCR the following sequence was obtained from Yq11.222. The M60 mutation itself was manually annotated (yellow below). The A allele is ancestral. This SNP is not currently listed in dbSNP but is only 10bp away from ss2941598 at location chrY:20348262-20348263 which was submitted as SMCY-M73/1.

 

 
>chrY:20348003+20348363 361bp CAGAATAATAGGAGAATTTTTGGT ATTTTCCTTATTTTCTAAGCAGC
CAGAATAATAGGAGAATTTTTGGTcaaataaaaggccatattatatttct
tttgataaaagtatcatgtgttcagtatgttttattatttgaaataatta
acatgacaggaatatatttgaaaaaaattccaaaaaaagctaaatataca
aactaagaaaattatatgattatacttatctgcagtattgtaaaacaata
gttccaaaaacttctgaattacaagtttaatacatacaacttcaattttc
[a/c]actacattgtggttagacgttcagaggaatcacaaaggacctcaacatg
ctagataagaaaatgtattttttaaatgttttggctcaGCTGCTTAGAAA
ATAAGGAAAAT
 

 

 

Occurrence

It was first described by Underhill et al (2000) where it was reported in 3 of 60 “Europeans” after genotyping 1062 individuals from a variety of countries. The SNP was originally detected scanning a global population of 53 individuals.   To date even though it has been tested in one major study of several thousand people, plus more recently genealogical testing by a wide range of people no further derived individuals have been found.  This is actually very surprising given its frequency observed in the original study. It is also unlikely that all were related and suggests an ancient origin. Again in the original study it was a subclade of what today would be called R1(xR1a1), and without retesting the original samples with the new SNPs available we do not know unambiguously where it resides on the current tree.

 

Summary

This SNP appears to be a private SNP, but sufficient doubt exists that the original samples, if still available, should be:

a)     All reamplified and sequenced to confirm the SNP location (only one was originally sequenced).

b)     An individual tested against current SNP panels to identify its exact location within the ISOGG tree.

 

References

Underhill PA, Shen P, Lin AA, Jin L, Passarino G, Yang WH, Kauffman E, Bonne-Tamir B, Bertranpetit J, Francalacci P, Ibrahim M, Jenkins T, Kidd JR, Mehdi SQ, Seielstad MT, Wells RS, Piazza A, Davis RW, Feldman MW, Cavalli-Sforza LL, Oefner PJ. 2000. Y chromosome sequence variation and the history of human populations. Nat. Genet. 26:358-361

Underhill, P.A., Passarino, G., Lin, A.A., Shen, P., Mirazon Lahr, M., Foley, R.A., Oefner, P.J. and Cavalli-Sforza, L.L. 2001. The phylogeography of Y chromosome binary haplotypes and the origins of modern human populations. Ann. Hum. Genet. 65: 43-62.

 

 

 

 

 

Hosted by www.Geocities.ws

1