Review questions, Nov 22

 

1. _______ of tRNA pairs with mRNA and the amino acid attachment site bind to an amino acid.  ________ of the ribosome holds tRNA carrying the next amino acid to be added.  _______ of the ribosome holds tRNA carrying a growing polypeptide.
1. Codon .............The A site .............The P site
2. Anticodon ........The A site .............The P site
3. Codon ............. The P site ............The R site
4. Anticodon ....... The P site ............ The A site
5. Codon ............  The R site.............The R site
6. Anticodon ......... The R site...........The A site

 

2. The below is a diagram of the translation machinery during _______ of translation.  The ribosome moves ________ .
1. initiation .............right
2. initiation..............left
3. elongation...........right
4. elongation...........left
5. termination..........right
6. termination..........left

 

3. Find the start codon in the following mRNA sequence (Use the codon table):

 

GUGGAUGAAGAAUUGGUGUUGAAAGC

 

4. Find the stop codon in the above sequence.

 

5. How many tRNAs does it require to translate the above sequence?

 

6. List the anticodons for the tRNA needed for translation of the above sequence.

 

7. Translate the above sequence.

 

8. The base substitution at the nucleotide position 19 U ® C would result in _______.

            a. no change in the amino acid sequence

b. substitution of the amino acid

c. premature introduction of a stop codon

d. frame-shift mutation

 

9. The deletion of the nucleotide 10 G would result in ________.

            a. no change in the amino acid sequence

b. substitution of the amino acid

c. premature introduction of a stop codon

d. frame-shift mutation

 

 

10.  The initiator tRNA contains anticodon _______ at one end and the amino acid _______ at the other end.

            a. AUG ..........Met

            b. ATG .......... Phe

            c. TAC .......... Phe

            d. UAC ..........Met

            e. UAA .......... Phe

 

 

11.  The diagrams below are different steps of translation.  Label each step using the following terms:

 

translocation, peptide bond formation, codon recognition, initiation, termination

 

 

 

12.  Place the above steps in the right order.

 

 

 

13. The function of tRNA during protein synthesis is to _____.

a. deliver amino acids to their proper site during protein synthesis

b. guide ribosome subunits out of the nucleus through nuclear pores

c. attach mRNA to the small subunit of the ribosome

d. process mRNA

e. transcribe mRNA

 

14. The P site of a ribosome does which one of the following?

a. It holds the tRNA that is carrying the next amino acid to be added to the growing polypeptide chain.

b. It holds the growing polypeptide chain.

c. It helps "unzip" DNA during transcription.

d. It catalyzes the addition of amino acids to the polypeptide chain of adjacent amino acids.

e. It recognizes the promoter during transcription initiation.

 

15. Which one of the following processes does NOT take place in the nucleus?

            a. transcription

            b. translation

            c. DNA replication

            d. RNA processing

            e. assembly of ribosomes

 

 

16. Ultraviolet (UV) radiation is damaging because it ____________.

a. prevents DNA transcription

b. prevents DNA translation

c. causes mutations in the DNA

d. deactivates the enzymes needed for DNA replication

e. inhibits protein synthesis

 

 

17. A particular ____ carry the information for making a specific polypeptide, but ____ can be used to make any polypeptide.

            a. gene and ribosome _________ mRNA and tRNA

            b. gene and mRNA __________ ribosome and tRNA

            c. ribosome and mRNA __________ tRNA and gene

            d. mRNA and tRNA __________ gene and ribosome

            e. ribosome and tRNA _________ mRNA and gene

 

 

18. Which of the followings is always true for the nucleotide contents in a DNA molecule?

a. A + T > C+ G

b. A + T = C + G

c. A + C > T + G

d. A + C = T + G