Bioinformatic
Assignment 5
Assignment 5
: this experiment could create phylogenetic tree using " Clustal W " and then compair the sequence of " Dinosure" to other animal for determine the ancestor of dinosure
sequence of Dinosure :
cccttctattattcattctcattctattcgttattcttgtactccacacatccaaa
caacaaagcataatattccacccattgagtccattcctatcctgattcttagtcccc
gaaccttttacactcacatg
First, we could be search the sequence of cytochrome b of all animal from NCBI's nucleotide database.In searching we sould be use the specific sciencific name of each species
Example
human : Homo sapien
rabbit : Oryctolagus cuniculus
The sequence use in the process sould be transfrom to FASTA format.
And then search all sequence and past to " Notepad "
Search the program of " Clustal W " from google and in this experiment we should be selected program " WWW.ebi.ac.uk."
Open the program that show the table for loading file and run program
when the program currently running that show this page
When finished is running the program that show several data
1. Score table page
2. Alignment page
3. Guide tree page
4. Cladogram
5. Pylogram
6. Show distance score
The result of alignment could be show as " Jalview alignment editor"
From the result can determine the relation between dinosure and other animal which can interpreted dog is the ancestor of dinosure because of the highest of homology score and can observe to pylogram that have the line of dinosure near the line of dog
Discussion
The pylogram may be show in other f rom when you use the sequence of each animal different the sequence that mention in above and in this experiment , the hypercrouse team do not define the specific species of each animal. So The same experiment may be generate different result.