Current time is 10:53:11.97p
Enter new time: 

BLASTN 2.0.10 [Aug-26-1999]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, 
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), 
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= gi|557821|emb|Z38061|SC9168 S.cerevisiae chromosome IX cosmid
9168 subsequence
         (50 letters)

Database: c:\school\cs290i\dna\blast\exe\yeast.nt
           3260 sequences; 14,686,544 total letters



                                                                   Score     E
Sequences producing significant alignments:                        (bits)  Value

emb|Z38061|SC9168 S.cerevisiae chromosome IX cosmid 9168               72  2e-014
gb|U33057|SCD9717 Saccharomyces cerevisiae chromosome IV cosmids...    27  0.50
gb|U00060|YSCH9332 Saccharomyces cerevisiae chromosome VIII cosm...    27  0.73

>emb|Z38061|SC9168 S.cerevisiae chromosome IX cosmid 9168
            Length = 42793
            
 Score = 71.6 bits (250), Expect = 2e-014
 Identities = 50/50 (100%)
 Strand = Plus / Plus

                                                              
Query: 1    tgggacagccattaacgatagaattacagctagttccttcggaggatcct 50
            ||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 5391 tgggacagccattaacgatagaattacagctagttccttcggaggatcct 5440


>gb|U33057|SCD9717 Saccharomyces cerevisiae chromosome IV cosmids 8166, 9787, 9717, and
             lambda 3073
             Length = 72119
             
 Score = 27.1 bits (89), Expect = 0.50
 Identities = 25/34 (73%)
 Strand = Plus / Plus

                                               
Query: 1     tgggacagccattaacgatagaattacagctagt 34
             ||  |||||||||||  |||  | || | |||||
Sbjct: 22833 tgttacagccattaatcatacgaataaaactagt 22866


>gb|U00060|YSCH9332 Saccharomyces cerevisiae chromosome VIII cosmid 9332
             Length = 36176
             
 Score = 26.6 bits (87), Expect = 0.73
 Identities = 23/30 (76%)
 Strand = Plus / Minus

                                           
Query: 11    attaacgatagaattacagctagttccttc 40
             || || ||  || ||| ||||||||||| |
Sbjct: 28457 atgaaggagtgacttaaagctagttcctcc 28428


  Database: c:\school\cs290i\dna\blast\exe\yeast.nt
    Posted date:  Dec 3, 1999  7:20 AM
  Number of letters in database: 14,686,544
  Number of sequences in database:  3260
  
Lambda     K      H
   0.192    0.173    0.357 

Gapped
Lambda     K      H
   0.192    0.173    0.357 


Matrix: blastn matrix:5 -4
Gap Penalties: Existence: 16, Extension: 4
Number of Hits to DB: 230
Number of Sequences: 3260
Number of extensions: 230
Number of successful extensions: 37
Number of sequences better than  2.0: 3
length of query: 50
length of database: 14,686,544
effective HSP length: 45
effective length of query: 5
effective length of database: 14,539,844
effective search space: 72699220
effective search space used: 72699220
T: 0
A: 0
X1: 37 (10.2 bits)
X2: 180 (49.7 bits)
S1: 81 (24.9 bits)
S2: 82 (25.2 bits)
Current time is 10:53:17.46p
Enter new time: 

